Logo Medical Science Monitor

Call: +1.631.470.9640
Mon - Fri 10:00 am - 02:00 pm EST

Contact Us

Logo Medical Science Monitor Logo Medical Science Monitor Logo Medical Science Monitor

05 July 2020: Animal Study

Therapeutic Effect of Berberine on Insomnia Rats by ErbB Signaling Pathway

Qingquan Wang 1ABE , Xiaojuan Ren 1C , Xingping Zhang 1DG* , Guanying Wang 1D , Hongxia Xu 1C , Ning Deng 2F , Tao Liu 1D , Zhipeng Peng 1B

DOI: 10.12659/MSM.921831

Med Sci Monit 2020; 26:e921831

Table 1 Primer sequences of key genes.

Erbb4ForwardCACAGCCCTCCTCCTGCCTAC
Erbb4ReverseGCCTCTGGTATGGTGCTGGTTG
Erbb2ForwardGGGCTGGCTCCGATGTGTTTG
Erbb2ReverseCCGCTGTAGAGGGCTGAGGTC
ArForwardGGCAGCAGTGAAGCAGGTAGC
ArReverseGGACAGAGCGAGCGGAAAGTTG
Grin2aForwardGTGTGATGCCTGTCTGCGGATG
Grin2aReverseCTGGAGGGCGTTGTTCTGTGAC

Your Privacy

We use cookies to ensure the functionality of our website, to personalize content and advertising, to provide social media features, and to analyze our traffic. If you allow us to do so, we also inform our social media, advertising and analysis partners about your use of our website, You can decise for yourself which categories you you want to deny or allow. Please note that based on your settings not all functionalities of the site are available. View our privacy policy.

Medical Science Monitor eISSN: 1643-3750
Medical Science Monitor eISSN: 1643-3750