Logo Medical Science Monitor

Call: +1.631.470.9640
Mon - Fri 10:00 am - 02:00 pm EST

Contact Us

Logo Medical Science Monitor Logo Medical Science Monitor Logo Medical Science Monitor

23 March 2022: Animal Study

Analysis of Genes Associated with Both Neural Tube Defects and Neuroectodermal Tumors

Rui Cao 12ABCDEFG , Jiaqi Li 1C , Li Zhang 13CE , Jianting Li 1AE , Yuxiang Liang 1C , Ruifang Ao 1F , Ying Wang 1D , Hang Li 1D , Xin Lu 1D , Zhizhen Liu 1A* , Hong Zhao 1AB* , Jun Xie 1AEG*

DOI: 10.12659/MSM.936079

Med Sci Monit 2022; 28:e936079

Supplementary Table 1 Primer sequences (for RT-qPCR in NTDs mice).

Gene symbolOrientationSequence
CDH1FCGCGGATAACCAGAACAAAGAC
RGAAACAGTAGGAGCAGCAGGAT
NCAM1FGACGCCGTCTTGGAACCTTT
RGAAATCCGACTCATTCAGGTCTC
ASCL1FACACGCACTCGCTGTTCTTC
RACCGACGGGGAAAAGATGATAA
SHHFCGGTGCAGGGAGGCTATTC
RCTGGAGGTGACGTAAGTAAAGTC

Your Privacy

We use cookies to ensure the functionality of our website, to personalize content and advertising, to provide social media features, and to analyze our traffic. If you allow us to do so, we also inform our social media, advertising and analysis partners about your use of our website, You can decise for yourself which categories you you want to deny or allow. Please note that based on your settings not all functionalities of the site are available. View our privacy policy.

Medical Science Monitor eISSN: 1643-3750
Medical Science Monitor eISSN: 1643-3750