Logo Medical Science Monitor

Call: +1.631.470.9640
Mon - Fri 10:00 am - 02:00 pm EST

Contact Us

Logo Medical Science Monitor Logo Medical Science Monitor Logo Medical Science Monitor

23 March 2022 : Animal Research  

Analysis of Genes Associated with Both Neural Tube Defects and Neuroectodermal Tumors

Rui Cao12ABCDEFG*, Jiaqi Li1C, Li Zhang13CE, Jianting Li1AE, Yuxiang Liang1C, Ruifang Ao1F, Ying Wang1D, Hang Li1D, Xin Lu1D, Zhizhen Liu1A, Hong Zhao1AB, Jun Xie1AEG

DOI: 10.12659/MSM.936079

Med Sci Monit 2022; 28:e936079

Supplementary Table 1 Primer sequences (for RT-qPCR in NTDs mice).

Gene symbolOrientationSequence
CDH1FCGCGGATAACCAGAACAAAGAC
RGAAACAGTAGGAGCAGCAGGAT
NCAM1FGACGCCGTCTTGGAACCTTT
RGAAATCCGACTCATTCAGGTCTC
ASCL1FACACGCACTCGCTGTTCTTC
RACCGACGGGGAAAAGATGATAA
SHHFCGGTGCAGGGAGGCTATTC
RCTGGAGGTGACGTAAGTAAAGTC

Your Privacy

We use cookies to ensure the functionality of our website, to personalize content and advertising, to provide social media features, and to analyze our traffic. If you allow us to do so, we also inform our social media, advertising and analysis partners about your use of our website, You can decise for yourself which categories you you want to deny or allow. Please note that based on your settings not all functionalities of the site are available. View our privacy policy.

Medical Science Monitor eISSN: 1643-3750
Medical Science Monitor eISSN: 1643-3750