Logo Medical Science Monitor

Call: +1.631.470.9640
Mon - Fri 10:00 am - 02:00 pm EST

Contact Us

Logo Medical Science Monitor Logo Medical Science Monitor Logo Medical Science Monitor

06 November 2024 : Clinical Research  

Comprehensive Analysis of Immune Infiltration and Key Genes in Peri-Implantitis Using Bioinformatics and Molecular Biology Approaches

Qingxun Meng12ABCE, Jing Han12AEFG*, Xi Zhang12CD, Wenxuan Su21BCF, Beibei Liu12BC, Taicheng Liu12BC

DOI: 10.12659/MSM.941870

Med Sci Monit 2024; 30:e941870

Table 1 Primer sequences of related genes.

GenePrimer sequences forwardPrimer sequences reverse
FCGR3ACCACTCCAGTGTGGCATCATTTGGGAGATCTTCAGTCCGC
CASP10CCTTGGAGCACACAGAGGATGATTTCATGGCCAGCCTTCAG
XBP1GAAGGCGCTGAGGAGGAAACACTTGCTGTTCCAGCTCACT
C1QBAGTAGGCTCTCGGCTCCTGTGTCAGACGCCTCCTGGG
SERPINB9ACTAGGTGGCAGGCCCGCAGAGGAGATGCTCACAGG
LGR4CTTCACCCAAGCGCTACAATCTCGAATGGCTTCACTGGGT
CHP2ACAGTATTCGGCGAGAGACCGGAGATCCATGCGGCTCAG
GAPDHGTGGACCTGACCTGCCGTCTAGGAGTGGGTGTCGCTGTTGAAGTC

Your Privacy

We use cookies to ensure the functionality of our website, to personalize content and advertising, to provide social media features, and to analyze our traffic. If you allow us to do so, we also inform our social media, advertising and analysis partners about your use of our website, You can decise for yourself which categories you you want to deny or allow. Please note that based on your settings not all functionalities of the site are available. View our privacy policy.

Medical Science Monitor eISSN: 1643-3750
Medical Science Monitor eISSN: 1643-3750