Logo Medical Science Monitor

Call: +1.631.470.9640
Mon - Fri 10:00 am - 02:00 pm EST

Contact Us

Logo Medical Science Monitor Logo Medical Science Monitor Logo Medical Science Monitor

23 May 2024 : Database Analysis  

MRTO4 Enhances Glycolysis to Facilitate HCC Progression by Inhibiting ALDOB

Yongyuan Zheng1ABCD, Yansong Huang1CDE, Weibing Li1CD, Hongqiu Cheng1AEG*

DOI: 10.12659/MSM.944685

Med Sci Monit 2024; 30:e944685

Table 2 Gene primer sequences.

GenesForward (5′-3′)Reverse (5′-3′)
MRTO4TGGCCAACATGAGGAACAGCTTCATCAGATGGGCTCCGAC
ALDOBGCCAGGGAAAGCTGTTCAGAAGGCCATCAAGCCCTTGAAT
GAPDHAGAAGGCTGGGGCTCATTTGCAGGGGTGCTAAGCAGTTGG

Your Privacy

We use cookies to ensure the functionality of our website, to personalize content and advertising, to provide social media features, and to analyze our traffic. If you allow us to do so, we also inform our social media, advertising and analysis partners about your use of our website, You can decise for yourself which categories you you want to deny or allow. Please note that based on your settings not all functionalities of the site are available. View our privacy policy.

Medical Science Monitor eISSN: 1643-3750
Medical Science Monitor eISSN: 1643-3750