17 December 2025 : Clinical Research
Reduced Methylation of IRF5 Gene as a Biomarker for Gestational Diabetes Mellitus
Mateusz Kunysz
ABCDEFG 1*, Marek Cieśla ABCDEF 2, Olimpia Mora-Janiszewska ABCDEF 1, Dorota Darmochwał-Kolarz ADE 1
DOI: 10.12659/MSM.948320
Med Sci Monit 2025; 31:e948320
Table 2 Characteristics of primers used to study methylation.
| Gene | Primer orientation | Sequence 5′→3′* | Amplicon size [bp] | Amplicon location with reference to assembly GRCh38 [chromosome: start: end: strand] |
|---|---|---|---|---|
| _sense_meth# | TGATTTATTCA | 161 | 4: 184474755: 184474915: 1 | |
| _antisense_meth | ATTAAAACAACC | |||
| _1_sense_meth | TTTTTTTTTTATTTAATTTG | 115 | 19: 49665937: 49666051: 1 | |
| _antisense_meth | TCTACTAAACATTATAC | |||
| _sense_meth | AATAGTTTAGGGTTTTTAT | 163 | 19: 49665684: 49665846: 1 | |
| _antisense_meth | ACTCAATAACTCTCAAACT | |||
| _sense_meth | AATTATTTGAATTGGAGG | 122 | 11: 616211: 616332: 1 | |
| _antisense_meth | AAAACAACTACACTTTATT | |||
| _sense_meth | AATTTAAAGGGGGTTGTA | 106 | 11: 616429: 616534: 1 | |
| _antisense_meth | TAATCAAACTAATATAACTCC | |||
| _sense_meth | TTAGTTTTTTGTAATTTAGAT | 115 | 14: 24161171: 24161285: 1 | |
| _antisense_meth | AACTAAAACTAATCTCTCC | |||
| * CpG sites in primer sequence are in underline; # primers are complementary to methylated sequences. IRF – interferon regulatory factor. | ||||