Logo Medical Science Monitor

Call: +1.631.470.9640
Mon - Fri 10:00 am - 02:00 pm EST

Contact Us

Logo Medical Science Monitor Logo Medical Science Monitor Logo Medical Science Monitor

01 August 2020: Clinical Research

Contributes to the Development of Colorectal Cancer via Recruiting CD11bTLR-4 Cells

Qun Deng 1ABCDEFG* , Changjian Wang 2BC , Kailin Yu 3DE , Yahui Wang 1EF , Qinyan Yang 2CD , Jingjing Zhang 1FG , Xiaoping Xu 4AG

DOI: 10.12659/MSM.921886

Med Sci Monit 2020; 26:e921886

Supplementary Table 1 The primers for genes detected by real-time polymerase chain reaction.

GeneForward primer (5′-3′)Reverse primer (5′-3′)
AACGCGAAGAACCTTACCAGGAGTGCCCAACTGAATGATG
Total bacterial DNAGCAGGCCTAACACATGCAAGTCCTGCTGCCTCCCGTAGGAGT
GAPDHCCCTTCATTGACCTCAACTACAATGACAAGCTTCCCGTTCTC

Your Privacy

We use cookies to ensure the functionality of our website, to personalize content and advertising, to provide social media features, and to analyze our traffic. If you allow us to do so, we also inform our social media, advertising and analysis partners about your use of our website, You can decise for yourself which categories you you want to deny or allow. Please note that based on your settings not all functionalities of the site are available. View our privacy policy.

Medical Science Monitor eISSN: 1643-3750
Medical Science Monitor eISSN: 1643-3750