Logo Medical Science Monitor

Call: +1.631.470.9640
Mon - Fri 10:00 am - 02:00 pm EST

Contact Us

Logo Medical Science Monitor Logo Medical Science Monitor Logo Medical Science Monitor

24 June 2020: Clinical Research

Comprehensive Analysis of Candidate Diagnostic and Prognostic Biomarkers Associated with Lung Adenocarcinoma

Jingyuan Li 1AE , Xingyuan Liu 23CF , Zan Cui 1B , Guanying Han 1DG*

DOI: 10.12659/MSM.922070

Med Sci Monit 2020; 26:e922070

Table 3 Primer pair sequences for RT-qPCR of PECAM1, CDK1, MKI67, SPP1, TOP2A, CHEK1, CCNB1, RRM2, and GAPDH.

GeneForward (5′-3′)Reverse (5′-3′)
PECAM1atgccagtggaaatgtcctcagaagtggtactggtg
CDK1ccgtcgtaacctgttgagtaactatgtctacccttatacaccacaccgtaa
MKI67cgcgaattcagagagcttttccagacaccatgcgagcctcgaggaagattgttggggtacccac
SPP1ttctgattgggacagccgtgtctcatcattggctttccgct
TOP2Aggtgagaaggactggcagaaatcttgtcgatgaagtacagggcta
CHEK1ccagatgctcagagattcttccatgttcaacaaacgctcacgatta
CCNB1ttcgcctgagcctattttggtaagctccatcttctgcatccacat
RRM2tttagtgagcttagcacagcgggaaaatctgcgttgaagcagtgaggc
GAPDHtccaccaccctgttgctgtagacttcaacagcaactcccac

Your Privacy

We use cookies to ensure the functionality of our website, to personalize content and advertising, to provide social media features, and to analyze our traffic. If you allow us to do so, we also inform our social media, advertising and analysis partners about your use of our website, You can decise for yourself which categories you you want to deny or allow. Please note that based on your settings not all functionalities of the site are available. View our privacy policy.

Medical Science Monitor eISSN: 1643-3750
Medical Science Monitor eISSN: 1643-3750