Logo Medical Science Monitor

Call: +1.631.470.9640
Mon - Fri 10:00 am - 02:00 pm EST

Contact Us

Logo Medical Science Monitor Logo Medical Science Monitor Logo Medical Science Monitor

05 October 2020 : Animal Research  

The Protein Kinase R Inhibitor C16 Alleviates Sepsis-Induced Acute Kidney Injury Through Modulation of the NF-κB and NLR Family Pyrin Domain-Containing 3 (NLPR3) Pyroptosis Signal Pathways

Jialu Zhou1B, Fan Zhang2B, Hongru Lin1B, Minxue Quan1B, Yaqin Yang1B, Yanni Lv3C, Zongnan He4CE, Yisong Qian1ACE*

DOI: 10.12659/MSM.926254

Med Sci Monit 2020; 26:e926254

Table 1 Primers used in real-time PCR reactions.

GeneForward primer (5′→3′)Reverse primer (5′→3′)
TNF-αGTGGAACTGGCAGAAGAGGCAAGAGGGAGGCCATTTGGGAAC
IL-1βAGGCTCCGATGAACAAAAGGCATTAGAAACAGTCC
IL-6GGAAATCGTGGAAATGAGGCTTAGGCATAACGCACT
MCP-1CTCTCTCTTCCTCCACCACCATAGCCGGCAACTGTGAACAG
iNOSCAGCTGGGCTGTACAAACCTTCATTGGAAGTGAAGCGTTTCG
COX-2GATGACTGCCCAACTCCCAACCCAGGTCCTCGCTTA
GAPDHACATGGCCTCCAAGGAGTAAGAAGGGATAGGGCCTCTCTTGCT

Your Privacy

We use cookies to ensure the functionality of our website, to personalize content and advertising, to provide social media features, and to analyze our traffic. If you allow us to do so, we also inform our social media, advertising and analysis partners about your use of our website, You can decise for yourself which categories you you want to deny or allow. Please note that based on your settings not all functionalities of the site are available. View our privacy policy.

Medical Science Monitor eISSN: 1643-3750
Medical Science Monitor eISSN: 1643-3750