Logo Medical Science Monitor

Call: +1.631.470.9640
Closed: National Holiday

Contact Us

Logo Medical Science Monitor Logo Medical Science Monitor Logo Medical Science Monitor

20 August 2021 : Animal Research  

Knockout of the Cannabinoid Receptor 2 Gene Promotes Inflammation and Hepatic Stellate Cell Activation by Promoting A20/Nuclear Factor-κB (NF-κB) Expression in Mice with Carbon Tetrachloride-Induced Liver Fibrosis

Cuizhen Long123ABCDEF, Na Xie12ABCDEF, Yuanhui Shu12ABCF, Yafeng Wu14ABCF, Ping He12BC, Yan Zhou12BC, Yining Xiang5CD, Junying Gu12CD, Lei Yang12DF, Yuping Wang12ABCDEFG*

DOI: 10.12659/MSM.931236

Med Sci Monit 2021; 27:e931236

Table 1 The primer sequences of CB2 gene used for PCR.

Primers typeSequence 5′-3′
Mutant forwardGGGGATCGATCCGTCCTGTAAGTCT
Common reverseGACTAGAGCTTTGTAGGTAGGCGGG
Wild-type forwardGGAGTTCAACCCCATGAAGGAGTAC
Three primers were simultaneously added to the PCR reaction system. Mutant forward and common reverse sequences can amplify 550 bp DNA products, common reverse and wild-type forward sequences can amplify 385 bp DNA products.

Your Privacy

We use cookies to ensure the functionality of our website, to personalize content and advertising, to provide social media features, and to analyze our traffic. If you allow us to do so, we also inform our social media, advertising and analysis partners about your use of our website, You can decise for yourself which categories you you want to deny or allow. Please note that based on your settings not all functionalities of the site are available. View our privacy policy.

Medical Science Monitor eISSN: 1643-3750
Medical Science Monitor eISSN: 1643-3750