Knockout of the Cannabinoid Receptor 2 Gene Promotes Inflammation and Hepatic Stellate Cell Activation by Promoting A20/Nuclear Factor-κB (NF-κB) Expression in Mice with Carbon Tetrachloride-Induced Liver Fibrosis

Cuizhen Long; Na Xie; Yuanhui Shu; Yafeng Wu; Ping He; Yan Zhou; Yining Xiang; Junying Gu; Lei Yang; Yuping Wang

doi:10.12659/MSM.931236

20 August 2021 : Animal Research

Knockout of the Cannabinoid Receptor 2 Gene Promotes Inflammation and Hepatic Stellate Cell Activation by Promoting A20/Nuclear Factor-κB (NF-κB) Expression in Mice with Carbon Tetrachloride-Induced Liver Fibrosis

Cuizhen Long^123ABCDEF, Na Xie^12ABCDEF, Yuanhui Shu^12ABCF, Yafeng Wu^14ABCF, Ping He^12BC, Yan Zhou^12BC, Yining Xiang^5CD, Junying Gu^12CD, Lei Yang^12DF, Yuping Wang^12ABCDEFG*

DOI: 10.12659/MSM.931236

Med Sci Monit 2021; 27:e931236

Authors information Article notes Copyright and License information

Background Material and Methods Results Discussion Conclusions References

Related articles Order reprints Share article Share by email

View HTML version

Table 1 The primer sequences of CB2 gene used for PCR.

Primers type	Sequence 5′-3′
Mutant forward	GGGGATCGATCCGTCCTGTAAGTCT
Common reverse	GACTAGAGCTTTGTAGGTAGGCGGG
Wild-type forward	GGAGTTCAACCCCATGAAGGAGTAC
Three primers were simultaneously added to the PCR reaction system. Mutant forward and common reverse sequences can amplify 550 bp DNA products, common reverse and wild-type forward sequences can amplify 385 bp DNA products.

Back to the Article

Knockout of the Cannabinoid Receptor 2 Gene Promotes Inflammation and Hepatic Stellate Cell Activation by Promoting A20/Nuclear Factor-κB (NF-κB) Expression in Mice with Carbon Tetrachloride-Induced Liver Fibrosis

Your Privacy