Logo Medical Science Monitor

Call: +1.631.470.9640
Mon - Fri 10:00 am - 02:00 pm EST

Contact Us

Logo Medical Science Monitor Logo Medical Science Monitor Logo Medical Science Monitor

07 March 2022 : Animal Research  

Astragalus Flavone Induces Proliferation and Differentiation of Neural Stem Cells in a Cerebral Infarction Model

Han Gao1CEF, Ningjing Huang1BE, Weiwei Wang1BC, Lingling Zhang1CD, Li Cai1D, Min Chen1F, Wentao Li1AG*

DOI: 10.12659/MSM.933830

Med Sci Monit 2022; 28:e933830

Table 1 Oligonucleotide sequences of primers utilized for qRT-PCR.

Target geneForward primerReverse primer
Notch1TGTTGTGCTCCTGAAGAACGGCAACACTTTGGCAGTCTCA
Jagged1GGGATTGCCCACTTTGAGTACCTTCCATGCAGGTTTTGTT
Mash1ACAAGAAGATGAGCAAGGTGCGGAGGAGTAGGACGAAA
Math1GGCTCAACTTCAGTGGCTTCGCCCAGGTTAACCAACTTGA
Ngn1CCAGCGATACAGAGTCCTCAGGAAAGGAGAAAAGGG
Ngn2GTCCTCCTCCAACTCCACGTGCATAACGGTGCTTCT
β-actin (reference gene)CCTAGACTTCGAGCAAGAGAGGAAGGAAGGCTGGAAGA

Your Privacy

We use cookies to ensure the functionality of our website, to personalize content and advertising, to provide social media features, and to analyze our traffic. If you allow us to do so, we also inform our social media, advertising and analysis partners about your use of our website, You can decise for yourself which categories you you want to deny or allow. Please note that based on your settings not all functionalities of the site are available. View our privacy policy.

Medical Science Monitor eISSN: 1643-3750
Medical Science Monitor eISSN: 1643-3750