Logo Medical Science Monitor

Call: +1.631.470.9640
Mon - Fri 10:00 am - 02:00 pm EST

Contact Us

Logo Medical Science Monitor Logo Medical Science Monitor Logo Medical Science Monitor

10 May 2022 : Laboratory Research  

Impact of Factors Secreted by Tumor Cells on Response of Pleural Mesothelial Cells to Different Sclerosing Agents in an In Vitro Model

Michał Mierzejewski ORCID logo1ABEF, Magdalena Paplińska-Goryca ORCID logo1ABCDE*, Rafał Krenke ORCID logo1ADEG

DOI: 10.12659/MSM.936065

Med Sci Monit 2022; 28:e936065

Table 1 Sequence of primers used in PCR.

Forward primerReverse primerProduct size
18s rRNAGGATGAGGTGGAACGTGTGATAGGTCTTCACGGAGCTTGTTG148
IL-6CCGGGAACGAAAGAGAAGCTGCGCTTGTGGAGAAGGAGTT67
IL-8GAGCACACAAGCTTCTATCAGGAAGGCTGCCAAGAG114
MMP9GCTCACCTTCACTCGCGTGCGCGACACCAAACTGGATG61
MCP-1GAGAGGCTGAGACTGTGCGAGCTTCAGTTTGAGAATT52
TGF-βCAGCAACAATTCCTGGCGATAAAGGCGAAAGCCCTCAATTT136
IL-17AAGGAATCACAATCCCACGAAATGGTGAGGTGGATCGGTTGTAGT149
IL-1βqHsaCIP0033362119

Your Privacy

We use cookies to ensure the functionality of our website, to personalize content and advertising, to provide social media features, and to analyze our traffic. If you allow us to do so, we also inform our social media, advertising and analysis partners about your use of our website, You can decise for yourself which categories you you want to deny or allow. Please note that based on your settings not all functionalities of the site are available. View our privacy policy.

Medical Science Monitor eISSN: 1643-3750
Medical Science Monitor eISSN: 1643-3750