19 April 2014: Lab/In Vitro Research
Calreticulin contributes to C1q-dependent recruitment of microglia in the leech Hirudo medicinalis following a CNS injury
Francoise Le Marrec-Croq DEF , Annelise Bocquet-Garcon BCD , Jacopo Vizioli BCD , Christelle Vancamp AB , Francesco Drago AB , Julien Franck BC , Maxence Wisztorski BC , Michel Salzet FG , Pierre-Eric Sautiere DEF , Christophe Lefebvre DEFG
DOI: 10.12659/MSM.890091
Med Sci Monit 2014; 20:644-653
Abstract
BACKGROUND: The medicinal leech is considered as a complementary and appropriate model to study immune functions in the central nervous system (CNS). In a context in which an injured leech’s CNS can naturally restore normal synaptic connections, the accumulation of microglia (immune cells of the CNS that are exclusively resident in leeches) has been shown to be essential at the lesion to engage the axonal sprouting. HmC1q (Hm for Hirudo medicinalis) possesses chemotactic properties that are important in the microglial cell recruitment by recognizing at least a C1q binding protein (HmC1qBP alias gC1qR).
MATERIAL AND METHODS: Recombinant forms of C1q were used in affinity purification and in vitro chemotaxis assays. Anti-calreticulin antibodies were used to neutralize C1q-mediated chemotaxis and locate the production of calreticulin in leech CNS.
RESULTS: A newly characterized leech calreticulin (HmCalR) has been shown to interact with C1q and participate to the HmC1q-dependent microglia accumulation. HmCalR, which has been detected in only some microglial cells, is consequently a second binding protein for HmC1q, allowing the chemoattraction of resident microglia in the nerve repair process.
CONCLUSIONS: These data give new insight into calreticulin/C1q interaction in an immune function of neuroprotection, suggesting another molecular target to use in investigation of microglia reactivity in a model of CNS injury.
Keywords: Amino Acid Sequence, Base Sequence, Biotinylation, Calreticulin - metabolism, Central Nervous System - pathology, Chemotaxis, Complement C1q - metabolism, Hirudo medicinalis - metabolism, Microglia - pathology, Molecular Sequence Data, Phylogeny, Protein Binding, RNA, Messenger - metabolism, Solubility
Background
Microglial cells constitute the resident immune cells, maintaining the integrity of the nervous system by constantly surveying the environment [1,2]. Under pathological conditions, they rapidly change and turn to amoeboid activated microglia in order to migrate over long distances and accumulate at lesions [3].
The microglia in the leech
In mammals, it is well established that C1q recognizes the C1qR(P) receptor to contribute to the phagocytosis of debris by microglia [18,19]. Some authors showed the importance of C1q in the microglial activation [20] and a neuroprotective role for C1q in early inflammatory response [21], but the C1q-dependent recruitment of mammalian microglia at lesions is still poorly understood. The chemotactic properties of C1q have been shown towards blood immune cells [22–24] and some authors specified that such chemotactic activity occurs through the recognition of both gC1qR (alias C1qBP) and calreticulin (also known as cC1qR, CalR, or CRT) receptors on peripheral dendritic cells [25].
In the leech CNS,
Material and Methods
LEECH CNS AND MICROGLIAL CELL PREPARATION:
H. medicinalis adult leeches were obtained from Ricarimpex (Eysines, France). The leech nerve cord (CNS) is constituted by the head ganglion, 21 body ganglia, and 7 fused tail ganglia. The ganglia are joined by structures, called connectives, containing the axonal processes and glial cells [9]. After anesthesia in 10% ethanol at 4°C for 15 min, animal CNS were dissected out in a sterile Ringer solution (115 mM NaCl, 1.8 mM CaCl2, 4 mM KCl, 10 mM Tris maleate, pH 7.4) under a laminar flow hood. After isolation, samples were placed in 3 successive baths of antibiotics (10 UI/ml penicillin, 10 μg/ml streptomycin, and 10 μg/ml gentamicin) for 15 min and further incubated in Leibovitz L-15 medium (Invitrogen, USA) containing 2 mM L-glutamin, 0.6% glucose, and 10 mM Hepes (complete medium). The experimental injury was performed by crushing the connectives between the third and fourth ganglia of an isolated fragment. Nerve cords were used for fluorescence in situ hybridization, whole mount immunohistochemistry, or nerve cell preparation.
For microglial cell isolations, nerve cords treated as indicated above were placed in 35-mm Petri dishes with 200 μl of complete L-15 medium. Each ganglion was carefully decapsulated by removing, with micro-scissors, the collagen layer enveloping the nerve cord. Nerve cells, neurons, and microglial cells were mechanically dissociated by gentle scraping (total nerve cells). After a filtration through 7-μm nylon mesh as described [13,26], the enriched microglial cell population was then collected and centrifuged at 1000 × g for 10 min at RT. The cell pellet was resuspended in L-15 medium (100 μl per nerve cord) for migration assays.
MOLECULAR CHARACTERIZATION OF HMCALR:
The analysis of Hirudo medicinalis genome allowed in silico prediction of mRNA databases according to intro-exon boundaries. Based on the candidate sequence detected, forward and reverse primers were designed to frame the complete sequence of predicted mRNA. From total RNA extracted from leech nerve cord using TRIzol® reagent and according to the manufacturer’s procedure (Invitrogen, USA), cDNA were synthesized using an oligo(dT) priming. The calreticulin-related molecule was amplified by PCR using the specific forward (5′GGTAGCAATACGTGCAGTTTG3′) and reverse (5′GCAACCAAGAGTAGGCAACC3′) primers and the Platinum®Taq DNA Polymerase according to the manufacturer’s instructions (Invitrogen, USA). Selected PCR products were ligated into pGEM T-easy vector and cloned into JM109 cells according to the manufacturer’s instructions (Promega, USA). Finally, products were sequenced using BigDye Terminator v3.0 polymerization kit before detection on Genetic Analyzer (Applied Biosystems, USA). BLAST programs were used for sequence analysis in databases and comparison with initial predicted mRNA sequence [27,28]. Phylogenetic analysis was carried out by Geneious® Basic v5.6 software [29].
:
Nerve cords were fixed for one hour at 4°C in 4% paraformaldehyde just after dissection. The 5′ biotin-labeled specific antisense probe and sense probe (negative control) were generated from the 842–1479 nucleotides sequence of hmcalr mRNA (Genbank Accession Number KF709537). After PCR amplification and the insertion of the product in pGEM-T easy vector system (Promega, USA), the RNA sequence of interest was obtained by in vitro transcription using DIG/Biotin RNA-labeling kit according to the manufacturer’s instructions (Roche, Switzerland). The hybridization protocol was performed as previously described [30]. Nerve cords were incubated with a secondary anti-biotin antibody conjugated to Alexa Fluor 488 (dilution 1: 5000 in PBS) (Invitrogen, USA). Samples were rinsed with PBS. Prior to mounting with Glycergel (Sigma Life Science, USA), the cell nuclei were counterstained by Hoechst 33342 fluorescent dye (1:1,000, Invitrogen USA) for 10 min. Slides were kept at 4°C in the dark until observation with a Zeiss LSM700 confocal microscope.
IMMUNOHISTOCHEMISTRY:
In experiments with anti-human calreticulin antibody, analyses were performed on nerve cords dissected out as described above. They were fixed for 1 hour at 4°C – immediately after dissection (T=0) or 24 h (T24h) after incubation in complete L-15 medium – in 4% paraformaldehyde, washed in PBS, permeabilized by a 24-h incubation at RT in 1% Triton X100 in PBS and pre-incubated for 8 h at RT in 1% Triton, 3% Normal Donkey Serum (NDS) and 1% ovalbumin in PBS. Samples were then incubated overnight at 4ºC with specific rabbit polyclonal anti-human calreticulin antibodies (Santa Cruz Biotechnology, USA) diluted in a PBS solution (1:250) containing 1% BSA, 0.05% Triton, 1% NDS, and 1% ovalbumin. The anti-calreticulin antibodies were directed against an antigen sequence corresponding to the Lys248-Leu417 region of human calreticulin, presenting 81% homology with leech calreticulin. After 3 washes with PBS, samples were incubated 1 h at room temperature with anti-rabbit donkey antibody (Invitrogen, USA) conjugated to Alexa Fluor 488 (1:2000) in a PBS solution containing 1% BSA, 0.05% Triton, 1% NDS, and 1% ovalbumin. Final rinsing and mounting steps for confocal microscopy observation were performed as described above. Prior to mounting, the cell nuclei were counterstained by Hoechst 33342 fluorescent dye (1: 1000, Invitrogen USA) for 10 min. Samples without the addition of primary antibody were used as negative control.
HUMAN C1Q BIOTINYLATION AND STREPTAVIDIN AFFINITY PURIFICATION:
The biotinylation of the recombinant human C1q (Prospecbio, USA) was carried out by using the Sulfo-NHS-SS-Biotin kit (Pierce, USA) according to the manufacturer’s instructions. Unreacted Sulfo-NHS-SS-Biotin was removed using the Zeba Desalt Spin Columns (Pierce, USA).
Biotinylated human C1q was immediately fixed onto a streptavidin column (Pierce, USA), previously equilibrated with 5 volumes of PBS 0.1M. The interaction between biotin and streptavidin occurred at RT for 10 min. Microglia protein extract (800 μg) was added in the column, incubated overnight at 4°C, and rinsed 10 times with PBS 0.1M. Captured microglial cell proteins were eluted from the streptavidin-agarose with 5% 2-mercaptoethanol-PBS 0.1 M at 30°C for 30 min. Proteins were precipitated in 10% trichloroacetic acid/acetone at −20°C for 45 min and centrifuged at 13000 × g for 15 min. The protein pellet was washed in cold acetone, air dried and dissolved in Læmmli buffer. Two other columns were used for the negative controls: the first containing the biotinylated human C1q without any microglia protein extract, and the second containing only the microglia protein extract to evaluate the unspecific reaction between streptavidin and microglial cell components. Samples were loaded on a 12% SDS-PAGE. Separated proteins were transferred to Amersham™ Hybond™-ECL nitrocellulose (GE Healthcare, France). The membrane was incubated for 30 min at RT in blocking solution (0.05% Tween, milk powder 5% w/v in PBS) and then overnight at 4°C in rabbit polyclonal anti-human calreticulin antibodies (Santa Cruz Biotechnology, USA), diluted at 1:5000 in blocking solution containing 1% ovalbumin. After rinsing with PBS-0.05% Tween, the membrane was incubated for 1 h at RT in secondary goat anti-rabbit polyclonal antibodies conjugated with horseradish peroxidase (Jackson Immunoresearch, USA) (dilution 1:20000). The signal was revealed using the ECL Kit SuperSignal West Dura chemoluminescent substrate (Pierce, USA) on Kodak X-Omat LS film (Sigma-Aldrich, USA).
CHEMOTAXIS ASSAYS:
In vitro chemotaxis assays were performed by using the double-P assay as described by Köhidai et al. with minor modifications [31]. Thirty-five millimeter Petri dishes were filled with 1 ml of a 0.5% agar and 1% gelatin solution. After drying, two 6-mm diameter wells were done, each presenting a parallel individual channel. One well was filled with 50 μl of purified microglial cells (see above) and the other with chemotactic factor or negative controls reagents. A channel was further created perpendicularly to others using a coverslip. One hour later, cells in the well containing chemoattractant were collected. Either vehicle (non-transformed Pischia pastoris culture supernatant) or recombinant HmC1q (rHmC1q) produced in P. pastoris [17] alone or with soluble CalR were used (8 μl) as chemotactic factors. For inhibitory chemotactic experiments, cells were pre-incubated for 1 h at RT either with rabbit polyclonal anti-human calreticulin antibodies (1:1000) or with rabbit IgG isotype as negative control (1:1000). The number of migrating cells was counted on a hemocytometer (3 different counts) under an Axioskop microscope (Zeiss, Germany). Experiments were done in triplicate. The results are expressed as the mean cell number ±S.D. Comparisons between means were made using Student’s t-test. Statistical differences were considered to be significant if p was <0.01.
Results
MOLECULAR CHARACTERIZATION OF HMCALR:
In mammals, C1q exerts a chemotactic activity on dendritic cells through different receptors: a gC1qR recognizing the globular head of C1q and a cC1qR recognizing the collagen domain of C1q. The presence of a putative calreticulin (cC1qR) was investigated in the leech H. medicinalis. Based on the H. medicinalis genome analysis, a sequence homologous to known calreticulin sequences was detected. The design of specific primers then allowed the amplification of a full-length mRNA sequence for a calreticulin-related molecule, named HmCalR (for Hirudo medicinalis Calreticulin). Hmcalr mRNA (Genbank KF709537) encodes a 420-amino-acid sequence with a theoretical molecular weight of 48 610 Da. The protein sequence presents a putative signal peptide and a calreticulin domain in Met1-Ser19 and in Val23-Ile334 amino-acid regions, respectively (Figure 1A). In addition, the analysis of HmCalR protein using a BLAST-P program shows a high conservation with human calreticulin, particularly in different domains that are already described for mammalian calreticulins [32]. As presented in Figure 1B, HmCalR might possess a single disulfide bridge (Cys107-Cys139) and contains a single histidine residue (His172). These residues were also described in an N-domain of the human mature calreticulin in Cys88-Cys120 and His153 positions, respectively, (numerated from the signal peptide-free sequence) and were demonstrated as essential for the chaperoning function [33,34]. The HmCalR sequence is also Proline-rich and exhibits 2 repeated amino-acid sequences – repeats A (PxxIxDPDAxKPEDWDE) and B (GxWxPPxIxNPxYx) – as observed in the human form’s P-domain (Figure 1B). In leeches, some non-essential amino acids have been substituted with different ones having equivalent physicochemical properties (Glu214 instead of Asp in human repeat A; and Val268 instead of Ile in human repeat B). Finally, the high conservation of numerous acidic residues in HmCalR suggests the presence of a C-domain, as in mammals.
Thus HmCalR presents sequence similarities with mammalian calreticulins and also with other forms from vertebrate, protostomian, and diploblastic species, as revealed by a neighbor-joining phylogenetic tree using selected sequences among them (Figure 2). Depending on the 200 highest similarities between calreticulin molecules and HmCalR, some were chosen to check the evolutive position of HmCalR according to species. The distribution of sequences in the cladogram respects the species organization between vertebrates and protostomians. The neighbor-joining phylogenetic tree shows that leech calreticulin is positioned in lophotrochozoan organisms sharing the same origin with Eisenia andrei, another annelid organism, and also close to mollusks. Arthropods have calreticulins that form a distinct group in protostomians, which is relevant in their distinction from the lophotrochozoans. Otherwise, although diploblastic organisms, cnidarians present higher similarities in calreticulin sequences with lophotrochozoans than with those of arthropods. Finally, vertebrate calreticulins are positioned in a distinct clade.
LOCALIZATION OF HMCALR MRNA AND HMCALR PROTEIN IN LEECH MICROGLIA:
Cells expressing hmcalr transcripts in the leech nervous system were investigated by specific fluorescence in situ hybridization (FISH) on injured nerve cords after different times. The transcripts were detected in only some scattered microglial cells among all microglial cells (blue nuclei) in the connectives 24 h after lesion. The labeling appears as a punctuated signal (Figure 3A). No specific signal was detected with sense riboprobes used as negative control (Figure 3A’).
Cells containing calreticulin protein were investigated by immunohistochemistry with rabbit polyclonal anti-human calreticulin antibodies on whole mounted injured nerve cords immediately after dissection (Figure 3B–3B4) and 24 h after lesion (Figure 3C, 3D). The microglia nuclei were simultaneously counterstained by using a Hoechst dye (blue nuclei). Immediately following the crush (T=0), calreticulin staining (green) was detected in only some microglial cells in the connectives among the whole microglia (blue nuclei). The HmCalR-positive microglia appeared spindle-shaped and very elongated, suggesting cell mobility. The labeling appeared vesicular (Figure 3B). Only a few microglial cells in the connective seemed to be positive for calreticulin, but the analyses of successive focal plans in the connectives allowed the observation of more microglial cells among the whole connective (Figure 3B–3B4). Twenty-four hours after injury, when the acute microglia migration declines, the calreticulin staining was detected in some ramified microglial cells distributed in the injured connectives (Figure 3C). In addition, the labeling was mainly localized around the nucleus and seemed to be vesicular in the microglia cytoplasm (Figure 3C). Negative controls performed using the secondary antibodies alone did not show any signal (Figure 3D).
BINDING PROPERTIES BETWEEN MICROGLIAL HMCALR AND C1Q:
Calreticulin (alias cC1qR) and C1qBP (alias gC1qR) bind to the collagen domain and globular head, respectively, of C1q [35]. Because previous results demonstrated an interaction between HmC1q and HmC1qBP in the leech CNS, co-purification experiments were performed to assess the putative presence of HmCalR [26]. Once biotinylated, human C1q was immobilized on a streptavidin column and incubated with leech microglia protein extracts (Figure 4A). Following the elution, the interactants of C1q were analyzed by Western blotting using polyclonal anti-human CalR antibodies (Figure 4B) that specifically recognized a unique ~55 kDa molecule (Figure 4B, lane1), probably corresponding to HmCalR due to the 81% identity of both leech and human antigenic sequences. This analysis presents a shift between the observed size and the expected one (48 610 Da for HmCalR containing the signal peptide). This difference of migration in SDS-PAGE was already reported for other calreticulins [36–39] and is probably due to the high content of acidic residues in the C-terminal end of the sequence. In the first negative control, when microglia protein extracts were incubated on a streptavidin column alone (Figure 4B, lane 2), no signal was obtained, showing that anti-human CalR antibodies do not react with leech microglial proteins non-specifically captured by streptavidin column. In the second negative control, when the biotinylated human C1q was loaded alone on streptavidin column (Figure 4B, lane 3), no immunoreactivity was detected, indicating that the anti-human CalR antibodies do not react with the human C1q. No signal was observed in negative controls using only the secondary antibody (Figure 4C). These results gave evidence of a specific interaction between human C1q and HmCalR protein present in leech microglia protein extract.
:
C1q has been shown to recruit leech microglial cells in a dose-dependent manner [17]. In the present study, leech microglial cells in L-15 medium were demonstrated to migrate towards the recombinant form of HmC1q (rHmC1q) about 6-fold more than towards vehicle (Figure 5). The pre-incubation of microglial cells with rabbit polyclonal anti-human calreticulin antibodies showed a significant decrease of the rHmC1q chemotactic effect (from 6-fold to 2.5-fold), whereas no significant inhibitory effect was detected with the rabbit IgG isotype as negative control. The microglial recruitment was also strongly reduced (from 6-fold to 2.3-fold) when rHmC1q was used in association with soluble CalR (sCalR) on cells in L-15 medium.
Discussion
As we previously described in the medicinal leech, the C1q molecule called
In mammals, the interaction between C1q and receptors such as gC1qR (C1qBP) and calreticulin (cC1qR) has so far been reported for dendritic cell chemoattraction [25] but never for microglia recruitment. We investigated in the leech CNS the existence of a calreticulin molecule and its involvement in microglial accumulation at the site of injury.
In the present report, the characterization of
Then we focused on a comparison of the different domains between the leech and the human forms. Human calreticulin is a 46-kDa chaperone protein containing 3 structurally and functionally distinct domains (N-, P-, and C-domains) [40–42]. The N- and P-domains in mammalian calreticulins are associated to the lectin-like chaperoning function [33,43], whereas the C-domain is involved in Ca2+ storage in the endoplasmic reticulum through its highly acidic properties [44]. The alignment between leech and human sequences shows that they share several of these structural features [33,34]. The leech molecule
The presence of
In the leech CNS, even if
In this report, due to
In mammals, C1q is the first component of the classical complement pathway. In early brain development, it mediates the CNS synapse elimination during neurogenesis [53]. In adult CNS disorders, C1q is also released by activated microglia to maintain and regulate their activation [20,54,55]. Among the mediators expressed by microglial cells and neurons, C1q seems to be a key molecule in neuroinflammatory diseases [56,57] and in various neurodegenerative pathologies such as Alzheimer disease [58–62]. Importantly, some studies recently showed that C1q also has complement cascade-independent activities [63,64]. C1q exerts (independently of its interaction with C1r and C1s) a neuroprotective effect against Amyloid-β plaques [21,65,66]. Of interest, our data in the leech suggest the importance of C1q in a non-classical complement pathway because the analysis of
In addition, other chemotactic factors allow the microglial accumulation at a lesion in the leech CNS [13,67] and also use specific receptors. Thus,
Conclusions
The complexity of immune responses following a CNS damage is enhanced by multiple cell origin and activation states of microglia [68]. In mammals, the resident microglia that result from the invasion processes during embryonic neurogenesis are helped by infiltrated bone marrow-derived cells and circulating monocytes during CNS diseases [69]. Nevertheless, despite
The medicinal leech as a model in nerve repair has been used for decades because it represents a new insight into study of the cell processes engaged during the axonal sprouting [72]. In addition, the leech microglia has been demonstrated to be essential for efficient nerve repair [12]. Because they are not supported by a significant infiltration of blood cells, microglial cells in the leech represent an alternate model of interest in comparative microglial studies. According to dynamic and functional properties, the microglia subpopulations may be actively involved in the repair capabilities. The impact of microglia recruitment under the influence of
References
1. Nimmerjahn A, Kirchhoff F, Helmchen F: Science, 2005; 308; 1314-18, pmid: 15831717
2. Olson JK, Miller SD, Microglia initiate central nervous system innate and adaptive immune responses through multiple TLRs: J Immunol, 2004; 173; 3916-24, pmid: 15356140
3. Hanisch UK, Kettenmann H, Microglia: active sensor and versatile effector cells in the normal and pathologic brain: Nat Neurosci, 2007; 10; 1387-94, pmid: 17965659
4. Del Rio-Hortega P, La microglia y su transformacion en células en bastoncito y cuerpos granulo-adiposos: Trab del Lab de Invest Biol, 1920; 18; 37 [in French]
5. Del Rio-Hortega P, Cytology and cellular pathology of the nervous system: Microglia, 1932; 483-534, New York, NY, P B Hoebaer
6. Sieger D, Peri F, Animal models for studying microglia: The first, the popular, and the new: Glia, 2013; 61; 3-9, pmid: 22987329
7. Baylor DA, Nicholls JG, Patterns of regeneration between individual nerve cells in the central nervous system of the leech: Nature, 1971; 232; 268-70, pmid: 4328425
8. Jansen JK, Nicholls JG, Regeneration and changes in synaptic connections between individual nerve cells in the central nervous system of the leech: Proc Natl Acad Sci USA, 1972; 69; 636-39, pmid: 4501577
9. Coggeshall RE, Fawcett DW, The Fine Structure of the Central Nervous System of the Leech, Hirudo Medicinalis: J Neurophysiol, 1964; 27; 229-89, pmid: 14129772
10. Le Marrec-Croq F, Drago F, Vizioli J, The Leech Nervous System: A Valuable Model to Study the Microglia Involvement in Regenerative Processes: Clinical and Developmental Immunology, 2013; 2013; 12
11. Morgese VJ, Elliott EJ, Muller KJ, Microglial movement to sites of nerve lesion in the leech CNS: Brain Res, 1983; 272; 166-70, pmid: 6616194
12. Ngu EM, Sahley CL, Muller KJ, Reduced axon sprouting after treatment that diminishes microglia accumulation at lesions in the leech CNS: J Comp Neurol, 2007; 503; 101-9, pmid: 17480028
13. Croq F, Vizioli J, Tuzova M, A homologous form of human interleukin 16 is implicated in microglia recruitment following nervous system injury in leech Hirudo medicinalis: Glia, 2010; 58; 1649-62, pmid: 20578037
14. Arafah K, Croix D, Vizioli J, Involvement of nitric oxide through endocannabinoids release in microglia activation during the course of CNS regeneration in the medicinal leech: Glia, 2013; 61; 636-49, pmid: 23355252
15. Duan Y, Sahley CL, Muller KJ, ATP and NO dually control migration of microglia to nerve lesions: Dev Neurobiol, 2009; 69; 60-72, pmid: 19025930
16. Samuels SE, Lipitz JB, Dahl G, Muller KJ, Neuroglial ATP release through innexin channels controls microglial cell movement to a nerve injury: J Gen Physiol, 2010; 136; 425-42, pmid: 20876360
17. Tahtouh M, Croq F, Vizioli J, Evidence for a novel chemotactic C1q domain-containing factor in the leech nerve cord: Mol Immunol, 2009; 46; 523-31, pmid: 18952286
18. Nepomuceno RR, Henschen-Edman AH, Burgess WH, Tenner AJ: Immunity, 1997; 6; 119-29, pmid: 9047234
19. Webster SD, Yang AJ, Margol L, Complement component C1q modulates the phagocytosis of Abeta by microglia: Exp Neurol, 2000; 161; 127-38, pmid: 10683279
20. Farber K, Cheung G, Mitchell D, C1q, the recognition subcomponent of the classical pathway of complement, drives microglial activation: J Neurosci Res, 2009; 87; 644-52, pmid: 18831010
21. Fraser DA, Pisalyaput K, Tenner AJ, C1q enhances microglial clearance of apoptotic neurons and neuronal blebs, and modulates subsequent inflammatory cytokine production: J Neurochem, 2010; 112; 733-43, pmid: 19919576
22. Leigh LE, Ghebrehiwet B, Perera TP, C1q-mediated chemotaxis by human neutrophils: involvement of gClqR and G-protein signalling mechanisms: Biochem J, 1998; 330(Pt.1); 247-54, pmid: 9461517
23. Kuna P, Iyer M, Peerschke EI, Human C1q induces eosinophil migration: Clin Immunol Immunopathol, 1996; 81; 48-54, pmid: 8808641
24. Ghebrehiwet B, Kew RR, Gruber BL, Murine mast cells express two types of C1q receptors that are involved in the induction of chemotaxis and chemokinesis: J Immunol, 1995; 155; 2614-19, pmid: 7650391
25. Vegh Z, Kew RR, Gruber BL, Ghebrehiwet B, Chemotaxis of human monocyte-derived dendritic cells to complement component C1q is mediated by the receptors gC1qR and cC1qR: Mol Immunol, 2006; 43; 1402-7, pmid: 16140380
26. Tahtouh M, Garcon-Bocquet A, Croq F, Interaction of HmC1q with leech microglial cells: involvement of C1qBP-related molecule in the induction of cell chemotaxis: J Neuroinflammation, 2012; 9; 37, pmid: 22356764
27. Altschul SF, Madden TL, Schaffer AA, Gapped BLAST and PSI-BLAST: a new generation of protein database search programs: Nucleic Acids Res, 1997; 25; 3389-402, pmid: 9254694
28. Karlin S, Altschul SF, Methods for assessing the statistical significance of molecular sequence features by using general scoring schemes: Proc Natl Acad Sci USA, 1990; 87; 2264-68, pmid: 2315319
29. Kearse M, Moir R, Wilson A, Geneious Basic: an integrated and extendable desktop software platform for the organization and analysis of sequence data: Bioinformatics, 2012; 28; 1647-49, pmid: 22543367
30. Nardelli-Haefliger D, Shankland M, Lox2, a putative leech segment identity gene, is expressed in the same segmental domain in different stem cell lineages: Development, 1992; 116; 697-710, pmid: 1363227
31. Kohidai L: Curr Microbiol, 1995; 30; 251-53, pmid: 7765899
32. Gelebart P, Opas M, Michalak M: Int J Biochem Cell Biol, 2005; 37; 260-66, pmid: 15474971
33. Guo L, Groenendyk J, Papp S, Identification of an N-domain histidine essential for chaperone function in calreticulin: J Biol Chem, 2003; 278; 50645-53, pmid: 14522955
34. Michalak M, Robert Parker JM, Opas M: Cell Calcium, 2002; 32; 269-78, pmid: 12543089
35. Kishore U, Reid KB, C1q: structure, function, and receptors: Immunopharmacology, 2000; 49; 159-70, pmid: 10904115
36. Baksh S, Michalak M: J Biol Chem, 1991; 266; 21458-65, pmid: 1939178
37. Rokeach LA, Haselby JA, Hoch SO, High-level bacterial expression, purification and characterization of human calreticulin: Protein Eng, 1991; 4; 981-87, pmid: 1817262
38. Krause KH, Ca(2+)-storage organelles: FEBS Lett, 1991; 285; 225-29, pmid: 1649772
39. Milner RE, Baksh S, Shemanko C, Calreticulin, and not calsequestrin, is the major calcium binding protein of smooth muscle sarcoplasmic reticulum and liver endoplasmic reticulum: J Biol Chem, 1991; 266; 7155-65, pmid: 2016321
40. Ellgaard L, Riek R, Braun D, Three-dimensional structure topology of the calreticulin P-domain based on NMR assignment: FEBS Lett, 2001; 488; 69-73, pmid: 11163798
41. Ellgaard L, Riek R, Herrmann T, NMR structure of the calreticulin P-domain: Proc Natl Acad Sci USA, 2001; 98; 3133-38, pmid: 11248044
42. Schrag JD, Bergeron JJ, Li Y, The Structure of calnexin, an ER chaperone involved in quality control of protein folding: Mol Cell, 2001; 8; 633-44, pmid: 11583625
43. Michalak M, Corbett EF, Mesaeli N, Calreticulin: one protein, one gene, many functions: Biochem J, 1999; 344(Pt 2); 281-92, pmid: 10567207
44. Nakamura K, Zuppini A, Arnaudeau S, Functional specialization of calreticulin domains: J Cell Biol, 2001; 154; 961-72, pmid: 11524434
45. Lacroix M, Dumestre-Perard C, Schoehn G, Residue Lys57 in the collagen-like region of human L-ficolin and its counterpart Lys47 in H-ficolin play a key role in the interaction with the mannan-binding lectin-associated serine proteases and the collectin receptor calreticulin: J Immunol, 2009; 182; 456-65, pmid: 19109177
46. Pagh R, Duus K, Laursen I, The chaperone and potential mannan-binding lectin (MBL) co-receptor calreticulin interacts with MBL through the binding site for MBL-associated serine proteases: Febs J, 2008; 275; 515-26, pmid: 18177377
47. Wang HC, Leu JH, Kou GH, Protein expression profiling of the shrimp cellular response to white spot syndrome virus infection: Dev Comp Immunol, 2007; 31; 672-86, pmid: 17188354
48. Watthanasurorot A, Jiravanichpaisal P, Soderhall I, Soderhall K: J Virol, 2010; 84; 10844-51, pmid: 20686021
49. Bohlson SS, Fraser DA, Tenner AJ, Complement proteins C1q and MBL are pattern recognition molecules that signal immediate and long-term protective immune functions: Mol Immunol, 2007; 44; 33-43, pmid: 16908067
50. Obeid M, Tesniere A, Ghiringhelli F, Calreticulin exposure dictates the immunogenicity of cancer cell death: Nat Med, 2007; 13; 54-61, pmid: 17187072
51. Ramirez G, Valck C, Molina MC, Trypanosoma cruzi calreticulin: a novel virulence factor that binds complement C1 on the parasite surface and promotes infectivity: Immunobiology, 2011; 216; 265-73, pmid: 20472323
52. Fricker M, Oliva-Martin MJ, Brown GC, Primary phagocytosis of viable neurons by microglia activated with LPS or Abeta is dependent on calreticulin/LRP phagocytic signalling: J Neuroinflammation, 2012; 9; 196, pmid: 22889139
53. Stevens B, Allen NJ, Vazquez LE, The classical complement cascade mediates CNS synapse elimination: Cell, 2007; 131; 1164-78, pmid: 18083105
54. Lynch NJ, Willis CL, Nolan CC, Microglial activation and increased synthesis of complement component C1q precedes blood-brain barrier dysfunction in rats: Mol Immunol, 2004; 40; 709-16, pmid: 14644096
55. Mariani MM, Kielian T, Microglia in Infectious Diseases of the Central Nervous System: J Neuroimmune Pharmacol, 2009; 4(4); 448-61, pmid: 19728102
56. Chen PC, Wang CR, Liu MF, Correlation between the renal C1q deposition and serum anti-C1q antibody: a potential role of anti-C1q antibody in lupus nephritis: Asian Pac J Allergy Immunol, 2002; 20; 223-27, pmid: 12744622
57. Trendelenburg M, Antibodies against C1q in patients with systemic lupus erythematosus: Springer Semin Immunopathol, 2005; 27; 276-85, pmid: 16189648
58. Bergamaschini L, Donarini C, Gobbo G, Activation of complement and contact system in Alzheimer’s disease: Mech Ageing Dev, 2001; 122; 1971-83, pmid: 11589915
59. Tacnet-Delorme P, Chevallier S, Arlaud GJ, Beta-amyloid fibrils activate the C1 complex of complement under physiological conditions: evidence for a binding site for A beta on the C1q globular regions: J Immunol, 2001; 167; 6374-81, pmid: 11714802
60. Fonseca MI, Kawas CH, Troncoso JC, Tenner AJ, Neuronal localization of C1q in preclinical Alzheimer’s disease: Neurobiol Dis, 2004; 15; 40-46, pmid: 14751769
61. Fonseca MI, Zhou J, Botto M, Tenner AJ, Absence of C1q leads to less neuropathology in transgenic mouse models of Alzheimer’s disease: J Neurosci, 2004; 24; 6457-65, pmid: 15269255
62. Stephan AH, Madison DV, Mateos JM, A dramatic increase of C1q protein in the CNS during normal aging: J Neurosci, 2013; 33; 13460-74, pmid: 23946404
63. Nayak A, Pednekar L, Reid KB, Kishore U, Complement and non-complement activating functions of C1q: a prototypical innate immune molecule: Innate Immun, 2012; 18; 350-63, pmid: 21450789
64. Nayak A, Ferluga J, Tsolaki AG, Kishore U, The non-classical functions of the classical complement pathway recognition subcomponent C1q: Immunol Lett, 2010; 131; 139-50, pmid: 20381531
65. Benoit ME, Hernandez MX, Dinh ML, C1q-induced LRP1B and GPR6 proteins expressed early in Alzheimer disease mouse models, are essential for the C1q-mediated protection against amyloid-beta neurotoxicity: J Biol Chem, 2013; 288; 654-65, pmid: 23150673
66. Benoit ME, Tenner AJ, Complement protein C1q-mediated neuroprotection is correlated with regulation of neuronal gene and microRNA expression: J Neurosci, 2011; 31; 3459-69, pmid: 21368058
67. Schikorski D, Cuvillier-Hot V, Boidin-Wichlacz C, Deciphering the immune function and regulation by a TLR of the cytokine EMAPII in the lesioned central nervous system using a leech model: J Immunol, 2009; 183; 7119-28, pmid: 19917687
68. Lively S, Schlichter LC, The microglial activation state regulates migration and roles of matrix-dissolving enzymes for invasion: J Neuroinflammation, 2013; 10; 75, pmid: 23786632
69. Mildner A, Schmidt H, Nitsche M, Microglia in the adult brain arise from Ly-6ChiCCR2+ monocytes only under defined host conditions: Nat Neurosci, 2007; 10; 1544-53, pmid: 18026096
70. Ransohoff RM, Microgliosis: the questions shape the answers: Nat Neurosci, 2007; 10; 1507-9, pmid: 18043584
71. Prinz M, Mildner A, Microglia in the CNS: Immigrants from another world: Glia, 2011; 59; 177-87, pmid: 21125659
72. von Bernhardi R, Muller KJ, Repair of the central nervous system: lessons from lesions in leeches: J Neurobiol, 1995; 27; 353-66, pmid: 7673894
In Press
Clinical Research
Analysis of the Clinical Characteristics and Endoscopic Features of Phytobezoar-Induced Ulcers and Gastric ...Med Sci Monit In Press; DOI: 10.12659/MSM.952191
Clinical Research
Effect of Indirect Co-Culture With Gingival Mesenchymal Stem Cells on Cytokine Secretion in Primary Oral Sq...Med Sci Monit In Press; DOI: 10.12659/MSM.952439
Clinical Research
Comparison of Sleep Architecture in Individuals Aged 65 to 80 Years With and Without Mild Cognitive Impairm...Med Sci Monit In Press; DOI: 10.12659/MSM.952493
Clinical Research
Effects of Single-Bout Endurance Exercise Intensity on Peripheral Neurotrophic Factors in Patients With Isc...Med Sci Monit In Press; DOI: 10.12659/MSM.952089
Most Viewed Current Articles
17 Jan 2024 : Review article 14,176,514
Vaccination Guidelines for Pregnant Women: Addressing COVID-19 and the Omicron VariantDOI :10.12659/MSM.942799
Med Sci Monit 2024; 30:e942799
13 Nov 2021 : Clinical Research 3,760,677
Acceptance of COVID-19 Vaccination and Its Associated Factors Among Cancer Patients Attending the Oncology ...DOI :10.12659/MSM.932788
Med Sci Monit 2021; 27:e932788
14 Dec 2022 : Clinical Research 2,466,264
Prevalence and Variability of Allergen-Specific Immunoglobulin E in Patients with Elevated Tryptase LevelsDOI :10.12659/MSM.937990
Med Sci Monit 2022; 28:e937990
16 May 2023 : Clinical Research 708,906
Electrophysiological Testing for an Auditory Processing Disorder and Reading Performance in 54 School Stude...DOI :10.12659/MSM.940387
Med Sci Monit 2023; 29:e940387






