29 January 2015: Animal Study
Sepsis Induced by Staphylococcus aureus : Participation of Biomarkers in a Murine Model
Thiago Henrique Caldeira de Oliveira ABCDEF , Aline Teixeira Amorim BD , Izadora Souza Rezende BD , Maysa Santos Barbosa BD , Hellen Braga Martins BD , Anne Karoline Pereira Brito BD , Ewerton Ferraz Andrade BD , Gleisy Kelly Neves Gonçalves BD , Guilherme Barreto Campos BDE , Robson Amaro Augusto Silva BCDE , Jorge Timenetsky ABCDEFG , Lucas Miranda Marques ABCDEFG
DOI: 10.12659/MSM.892528
Med Sci Monit 2015; 21:345-355
Abstract
BACKGROUND: This study aimed to evaluate the role of biomarkers in the pathophysiological process induced by a Staphylococcus aureus strain obtained in a hospital environment. For this, we intraperitoneally inoculated groups of male BALB/c mice with S. aureus, using a clinical isolate (CI) of S. aureus.
MATERIAL AND METHODS: Mice were divided into groups according to time of euthanasia (24, 48, 72, 96, 120, 144, and 168 hours of infection). After being euthanized, blood samples were collected for quantification of microorganisms and leukocytes, as well as measurement of biomarkers of tumor necrosis factor alpha (TNF-α), interleukin 6 (IL-6), C-reactive protein (CRP), and Procalcitonin (PCT) by ELISA. Heart, kidneys, and lungs were removed for histopathological analysis, assessment of biomarkers of tissue expression by RT-PCR (polymerase chain reaction with reverse transcriptase), and quantification of microorganisms by real-time quantitative PCR (real-time PCR).
RESULTS: The animals infected at between 120 hours and 168 hours had the highest blood levels of S. aureus. We observed that infection promoted increases in the levels of circulating neutrophils and monocytes. However, there was a reduction of circulating neutrophils and monocytes after 96 hours of infection. The infected mice also had increased levels of blood lymphocytes. In this model of infection with S. aureus, IL-6, CRP, and PCT demonstrated greater fidelity as markers of infection, since serum levels were elevated and lowered along with the number of circulating neutrophils and monocytes after resolution of the infection. The lungs showed hyperemia, with enlargement of the alveolar septa. On the other hand, infection with S. aureus did not promote visible change in histological tissue in the heart and kidneys.
CONCLUSIONS: In this model of infection with S. aureus, IL-6, CRP, and PCT demonstrated greater fidelity as markers of infection, since serum levels were elevated and lowered along with the number of circulating neutrophils and monocytes after resolution of the infection. We believe our results may provide a better understanding of the pathophysiology, as well as aid in the search for a more reliable method of diagnosis.
Keywords: Biological Markers - metabolism, C-Reactive Protein - chemistry, Calcitonin - blood, Enzyme-Linked Immunosorbent Assay, Inflammation - microbiology, Interleukin-6 - blood, Leukocyte Count, Protein Precursors - blood, Real-Time Polymerase Chain Reaction, Reverse Transcriptase Polymerase Chain Reaction, Sepsis - physiopathology, Staphylococcal Infections - physiopathology, Tumor Necrosis Factor-alpha - blood
Background
Sepsis is an acute inflammatory response against an infective organism, accompanied by a complex cascade of cellular and chemical interactions. The aim of the hyperdynamic sate is to eliminate the invasive organism from the body. Despite this protective mechanism, the acute response can lead to tissue damage and cause life-threatening complication if not properly and quickly treated [1]. The incidence of sepsis has increased in recent years due to the increase of the elderly population, longer hospitalization, and more invasive procedures; therefore, sepsis is growing in epidemiological importance [2]. Nosocomial infectious due to contaminated intravenous fluid, blood products, and medications have been documented [3]. The mortality rates of sepsis range from 12.8% for sepsis and 20.7% for severe sepsis, to up to 45.7% for septic shock [4].
The lipopolysaccharide (LPS) of gram-negative bacteria is known to be the main constituent inducing sepsis, which stimulates the release of endogenous mediators responsible for pathophysiological changes associated with high mortality [5]. Recent clinical studies have demonstrated that the causes of sepsis by gram-positive bacteria have been increasing, being responsible for 50% of cases of severe sepsis or septic shock in hospital intensive care units (ICUs) [6].
Biomarkers for sepsis include interleukin 6 (IL-6), tumor necrosis factor alpha (TNF-α) and C-reactive protein (CRP), and procalcitonin (PCT) has recently received considerable attention. IL-6 is a cytokine acting in both innate immune responses, synthesized by monocytes, endothelial cells, fibroblasts, and other cells in response to microorganism stimulation [10]. TNF-α is the main mediator of the acute inflammatory response to gram-negative bacteria and other infectious microorganisms. This cytokine is responsible for many systemic complications in severe infections, such as disseminated intravascular coagulation [11].
CRP is an acute-phase protein produced by hepatocytes, and activates the complement system. It is used as a marker of inflammation and tissue damage [12]. Systemic levels of CRP are elevated in septic patients compared with non-septic patients [13]. PCT is a pro-hormone calcitonin, and studies show that their serum levels can be used to distinguish symptoms of sepsis from a non-infectious inflammatory response, being an important biomarker for differential diagnosis [14]. However, the sepsis diagnosis and assessment of severity becomes complicated due to the highly variable nature of its signs and symptoms, as well as by the lack of sensitive and specific laboratory tests in differentiating between infectious and noninfectious cases [15].
Therefore, there is a need for biomarkers that can be used to assess the severity and the evolution of infection. The aim of this study was to evaluate the role of biomarkers in sepsis induced by
Material and Methods
BACTERIA:
A clinical isolate of S. aureus (CI) was used in this study. This isolate was obtained from a previous study that examined the presence of this organism in a hospital environment. In this study, clinical samples were obtained from ICU environments and equipment surfaces with a high possibility of contamination. In the same study, selection tests and isolation of sensitivity to antibiotics, of biofilm formation, and extraction of DNA for amplification of the mecA gene were done, which were positive for methicillin resistance. Pathogenicity tests for the detection of virulence genes also were done, which proved positive for staphylococcal enterotoxin type A genes (SEA), staphylococcal enterotoxin type B (SEB), leukocidin Panton-Valentine (PVL), and the IgG binding region and X region of protein A (Spa) [16]. Staphylococci were grown, cloned, and stored at −70°C. BHI (brain heart infusion) and mannitol salt agar (MSA) were used to cultivate the strain S. aureus for subsequent infection of the animals.
ANIMALS:
Forty-five male BALB/c mice (6–8 weeks old), provided by the University of Campinas, São Paulo, were used. BALB/c mice are widely used for the study of sepsis. BALB/c mice tend to generate humoral immunity and Th2 cytokines, a process that has sometimes been associated with development of sepsis [17]. The animals received food and water ad libitum. The study was conducted at the Laboratory of Microbiology and Immunology, Institute for Multidisciplinary Health, Federal University of Bahia, Brazil. The study was approved by the Ethics Committee on Animal Use (CEUA), University of São Paulo.
EXPERIMENTAL INFECTION OF MICE:
Groups of BALB/c mice were inoculated intraperitoneally with
FLUID AND TISSUE COLLECTION:
After euthanasia, blood samples were collected into tubes with EDTA and without EDTA. The samples with EDTA were used for total and differential blood count. The samples without EDTA were centrifuged at 2200
Heart, kidneys, and lungs were removed and fractionated for analysis. A portion of the material was used for histopathology. The other part was stored at −80ºC for the performance of molecular techniques (RT-PCR and qPCR).
TOTAL AND DIFFERENTIAL BLOOD CELL COUNT:
For total blood cell count, 20 μl of blood (collected in EDTA) were mixed with 400 μl of liquid thinner and the sample was transferred to a Neubauer chamber to perform the leukocyte count in an increase of 40×. The differential blood cell count was stained by a Panoptic kit. One hundred leukocytes were counted using an immersion objective and the different types of leukocytes and their values were counted and recorded. Based on the total leukocyte count and percentage values found in the differential count, the absolute values were calculated for each leukocyte.
:
The blood DNA was extracted according to the protocol of an Invitek (Stratec®) kit. DNA from tissue was extracted by the phenol-chloroform-thiocyanate using the Trizol® platform [18]. The real-time PCR was performed in duplicate, using the Applied Biosystems platform. This technique was performed by using TaqMan Probe using a basic amplification protocol. This protocol included, in a final reaction volume of 25 μl, 12.5 μl of Master Mix (Applied Biosystems), 1.12 μl of primer LTnucF (AAATTACATAAAGAACCTGCGACA), 1.12 μl of primer LTnucR (GAATGTCATTGGTTGACCTTTGTA) (20 pmol), 0.75 μl probe (10 mM), 7.0 μl of water, and 2.5 μl of DNA. Quantification was performed using an absolute quantification technique, based on a predetermined standard curve ranging from 107 to 10 microorganisms/uL.
MEASUREMENT OF BIOMARKERS:
Sandwich ELISA was performed on biomarkers IL-6 (eBIOSCIENCE), TNF-α (eBIOSCIENCE), PCR (Life Diagnostics), and PCT (RayBio®). An ELISA 96-well plate was sensitized with a specific capture antibody and incubated overnight at 4°C. The wells were washed to remove free antibodies. After washing, the detection antibody was added. The wells were washed again and added to the secondary antibody conjugated to streptavidin peroxidase enzyme. After further washing, a substrate solution of tetramethylbenzidine (TMB) was added to the wells and the color developed in proportion to the amount of biomarker. The stop solution was added to the following section, changing the color from blue to yellow, and the color intensity was measured in an ELISA reader at 450 nm.
RNA ISOLATION AND RT-PCR:
Total RNAm was extracted by the phenol-chloroform-thiocyanate using Trizol®. Extracted RNAm was quantified by spectrophotometry (NanoDrop ND-1000, Witec Ag, Littau, Switzerland). Equal amounts of RNAm per tissue were subjected to reverse transcription (RT) by Random oligo dT-primers with reverse transcriptase (Invitrogen®). After cDNA synthesis, polymerase chain reaction (PCR) amplification of the cDNA was performed for TNF-α, IL-6, PCT, and CRP. The amplified cDNA was electrophoresed in 1% agarose gels containing ethidium bromide, and quantities were analyzed by densitometry using ImageJ software (the Research Service Branch of the National Institute of Health, Bethesda, MD, USA). The relative expression of each gene was normalized to the intensity of a housekeeping gene, β-actin. The expression level of each gene is reported as a ratio relative to the level of normalized expression in a control sample.
MORPHOLOGICAL AND HISTOLOGICAL ANALYSIS:
Heart, kidney, and lung tissues were fixed in methacarn solution (60% methanol, 30% chloroform, and 10% glacial acetic acid) for approximately 24 hours, embedded in paraffin, and cut into 4-μm sections. The slides were stained with hematoxylin and eosin to evaluate the intensity of inflammation. The measurements were performed with the aid of a computerized interactive image analysis (Image Pro Plus 4.1 imaging software from Media Cybernetics, Silver Spring, MD, USA) and based on the scoring standard. A video camera attached to the microscope optical system transmitted from each microscopic field, which was converted into a digital image.
STATISTICAL ANALYSIS:
Statistical analysis was performed using GraphPad Prism, 5.0 (GraphPad Software, San Diego, CA, USA). The comparisons made in the experiments and were determined by individual variability or error variation (s2) by analysis of variance one-way ANOVA followed by the Newman-Keuls test of comparison. The results are expressed as mean plus or minus the standard error of the mean. Statistical differences were considered significant at
Results
:
Infected animals showed higher levels of S. aureus in blood between 120 hours and 168 hours of infection (Figure 1). However, no S. aureus was detected by qPCR in any of the organs studied.
LEUKOCYTE COUNT:
We observed that infection promoted increases in the levels of circulating neutrophils (Figure 2A) and monocytes (Figure 2B). However, there was a reduction of circulating neutrophils and monocytes after 96 hours of infection. The infected mice also had increased levels of blood lymphocytes (Figure 2C). The lymphocytes showed significant decreases after 72 hours of infection. However, there was a considerable tendency to return to baseline by 168 hours (Figure 2C).
BIOMARKER SERUM LEVELS AND GENE EXPRESSION:
To study the mechanisms involved in the different response times of infection, we analyzed serum levels of TNF-α, IL-6, PCT, and CRP by ELISA after infection with S. aureus. In infected animals, the serum levels of biomarkers increased in direct relation to the time of infection. The increase in serum was more significant with respect to IL-6 (Figure 3A), CRP (Figure 3C), and PCT (Figure 3D) compared to the control group. A borderline significant correlation was observed in TNF-α dosages (Figure 3B). Infected animals showed an increased expression of IL-6 in the heart within 48 hours of infection (Figure 4A). In the kidney, the increase was more evident at 96 hours (Figure 4B), and in the lung there was a more pronounced increase of IL-6 at 72 hours of infection (Figure 4C). There was a significant increase in the expression of PCT, which was more evident within 96 hours of infection in the heart (Figure 5A), kidney (Figure 5B) and lung (Figure 5C). Infected animals also showed significant increases in gene expression of CRP in the heart within 24 hours of infection (Figure 6A), and 48 hours in the kidney (Figure 6B) and lung (Figure 6C), as well as an increased gene expression of TNF-α between 48 and 72 hours of infection in the heart (Figure 7A), kidney (Figure 7B), and lung (Figure 7C). In this model of infection with S. aureus, IL-6, CRP and PCT demonstrated greater fidelity as markers of infection, since serum levels were elevated and lowered along with the number of circulating neutrophils and monocytes after resolution of the infection.
HISTOLOGICAL INFLAMMATION:
No histological changes were observed in infected animals in the heart or kidneys (data not shown). These animals differed in the histological analysis of the lungs. In the control group and 24 hours after infection, we observed clear alveoli without cellular infiltration. However, there was marked hyperemia with more pronounced enlargement of the alveolar septa between 48 and 96 hours, and it was less pronounced, but still present, within 144 hours and 168 hours (Figure 8).
Discussion
Infected animals showed higher levels of
The ability to up-regulate virulence factors under stress stimuli (e.g., the host immune response) is a key factor in the persistence of
We also observed that infection with the ATCC strains and clinical isolates promoted increases in the levels of circulating neutrophils and monocytes and that infected mice had increased levels of blood lymphocytes. However, there was a reduction of circulating neutrophils and monocytes after 96 hours of infection. These findings are consistent with other studies previously reported in the literature [2,24,25]. Inappropriate activation of neutrophils contributes to the pathological manifestation of multiple organ failure [25]. Thus, the increase of neutrophils may have contributed to the elimination of the microorganism. In this study, we observed that there was a resolution of the infection. The increase and the decrease of
The lymphocytes showed significant decreases after 72 hours of infection. However, there was a considerable tendency to return to baseline by 168 hours. As shown here, as the infection resolves, the number of lymphocytes returns to baseline. During sepsis, lymphocyte depletion may occur [24]. These data are consistent with our findings, and show that apoptosis is essential for the resolution of inflammation, with a balance between the recruitment of leukocytes and their removal at the site of infection, which enhances host defenses so as to minimize cytotoxicity to the host. However, an important question about the death of lymphocytes during sepsis is whether it is beneficial or detrimental to the host. Although there is a possibility that lymphocyte death is beneficial because it causes down-regulation of the inflammatory response, this response can be detrimental because an abrupt loss of immune cells may compromise the ability of the host to eliminate infection [28].
In the present study, infection with
PCT has been proposed as a marker of bacterial infection in critically ill patients [33]. Biju et al. [34] demonstrated the value of PCT as an early biomarker in radiation-induced bacteremia for mouse studies and suggested that clinical results from other septic conditions may apply to postradiation septicemia in humans. Unlike other biomarkers, it is not induced in autoimmune or neoplastic disorders, or in infections limited to a single organ, showing it to be extremely useful in the differential diagnosis of bacterial diseases [35]. According to Morgenthaler et al. [36], in a model of sepsis in primates, there was a large production of PCT in the liver, kidney, aorta, adipose tissue, ovaries, bladder, and adrenal glands. Chan, et al. [37] observed that infected patients showed increased plasma levels of PCT, showing it to be a good marker of severity of infection. According to Hausfater et al. [38], 195 patients with suspected infection showed elevated plasma levels of PCT. PCT appears to be a well-established biomarker of sepsis that fulfills several clinical needs: its responds both to infection and severity of inflammation and thus has a impact on therapy [39].
CRP is an acute-phase protein produced predominantly by hepatocytes and secreted into the serum. However, many lines of evidence indicate that it may be produced by other cells such as monocytes [40,41]. According to Dong and Wright [42], the CRP expression observed in the lungs is related especially to alveolar macrophages in mice subjected to infection. As a biomarker, Povoa [12] observed that patients with proven infection showed elevated plasma levels of CRP compared with those without proven infection. The plasma levels of CRP is determined exclusively by its rate of synthesis and disease activity [43]. Moreover, Kubler et al. [44] reported that patients treated with recombinant human activated proteín C showed lower relative risk of death than those who were not treated. However, it is not considered an exclusive marker for sepsis becauser it can be found high in other non-infectious conditions [37].
Studies show that the lungs are affected early in sepsis, and this can lead to serious injury in lung tissue [45]. Another study showed that septic lung infections were the primary source of infection in 47% of patients [46]. The lung injury caused after an abdominal infection is caused by contributions from neutrophils, platelets, the complement system, cytokines, and free radicals. The reactive oxygen species, released by neutrophils, contribute to increased lung injury [47]. Although
The non-occurrence of histological changes visible in both heart and kidneys of infected animals may be due to the process of resolution of the inflammatory state. Although there was no visible damage to the tissues, we observed an inflammatory process by the release of inflammatory cells. The initial peritonitis caused by
Conclusion
The results of this study demonstrated that infection with
References
1. Gutierrez J, Hossam A, Lazarezcu R, Effect of beta blockers on sepsis outcome: Med Sci Monit, 2009; 15(10); CR499-503, pmid: 19789508
2. Cabrera-Perez J, Condotta SA, Badovinac VP, Griffith TS, Impact of sepsis on CD4 T cell immunity: J Leukoc Biol, 2014 [Epub ahead of print]
3. Achkar MA, Rogers JS, Muszynski MJ, Pantoea species sepsis associated with sickle cell crisis in a pregnant woman with a history of pica: Am J Case Rep, 2012; 13; 26-28, pmid: 23569479
4. Ribas VJ, Lopez JC, Ruiz-Sanmartin A, Severe sepsis mortality prediction with relevance vector machines; 2011; 100-3
5. Grandel U, Fink L, Blum A, Endotoxin-induced myocardial tumor necrosis factor-alpha synthesis depresses contractility of isolated rat hearts: evidence for a role of sphingosine and cyclooxygenase-2-derived thromboxane production: Circulation, 2000; 102(22); 2758-64, pmid: 11094044
6. Yi C, Cao Y, Mao SH: Inflamm Res, 2009; 58(12); 855-62, pmid: 19536455
7. Sahm DF, Marsilio MK, Piazza G, Antimicrobial resistance in key bloodstream bacterial isolates: electronic surveillance with the Surveillance Network Database – USA: Clin Infect Dis, 1999; 29(2); 259-63, pmid: 10476722
8. Hotchkiss RS, Karl IE, The pathophysiology and treatment of sepsis: N Engl J Med, 2003; 348(2); 138-50, pmid: 12519925
9. Gullo A, Bianco N, Berlot G, Management of severe sepsis and septic shock: challenges and recommendations: Crit Care Clin, 2006; 22(3); 489-501, pmid: 16893735
10. Ventetuolo CE, Levy MM, Biomarkers: diagnosis and risk assessment in sepsis: Clin Chest Med, 2008; 29(4); 591-603, pmid: 18954695
11. Levi M, Ten Cate H, Disseminated intravascular coagulation: N Engl J Med, 1999; 341(8); 586-92, pmid: 10451465
12. Povoa P, C-reactive protein: a valuable marker of sepsis: Intensive Care Med, 2002; 28(3); 235-43, pmid: 11904651
13. Lausevic Z, Vukovic G, Stojimirovic B, Kinetics of C-reactive protein, interleukin-6 and -10, and phospholipase A2-II in severely traumatized septic patients: Vojnosanit Pregl, 2010; 67(11); 893-97, pmid: 21268514
14. Reinhart K, Bauer M, Riedemann NC, Hartog CS, New approaches to sepsis: molecular diagnostics and biomarkers: Clin Microbiol Rev, 2012; 25(4); 609-34, pmid: 23034322
15. Lever A, Mackenzie I, Sepsis: definition, epidemiology, and diagnosis: BMJ, 2007; 335(7625); 879-83, pmid: 17962288
16. Campos GB, Souza SG, Lob OT: New Microbiologica, 2012; 35(2); 183-90, pmid: 22707131
17. Ferguson NR, Galley HF, Webster NR, T helper cell subset ratios in patients with severe sepsis: Intensive Care Med, 1999; 25(1); 106-9, pmid: 10051087
18. Thomas LC, Gidding HF, Ginn AN: J Microbiol Meth, 2007; 68(2); 296-302
19. Verdrengh M, Tarkowski A: Arthritis Rheum, 2000; 43(10); 2276-82, pmid: 11037887
20. Goetghebeur M, Landry PA, Han D, Vicente C: Can J Infect Dis Med Microbiol, 2007; 18(1); 27-34, pmid: 18923684
21. Naber CK: Clin Infect Dis, 2009; 48(Suppl 4); S231-37, pmid: 19374578
22. Weidenmaier C, Kokai-Kun JF, Kristian SA: Nature Med, 2004; 10(3); 243-45, pmid: 14758355
23. Bone RC, The pathogenesis of sepsis: Ann Intern Med, 1991; 115(6); 457-69, pmid: 1872494
24. Azevedo LC, The many facets of sepsis pathophysiology and treatment: Shock, 2013; 39(Suppl 1); 1-2, pmid: 23591605
25. Brown KA, Brain SD, Pearson JD, Neutrophils in development of multiple organ failure in sepsis: Lancet, 2006; 368(9530); 157-69, pmid: 16829300
26. Lieschke GJ, Grail D, Hodgson G, Mice lacking granulocyte colony-stimulating factor have chronic neutropenia, granulocyte and macrophage progenitor cell deficiency, and impaired neutrophil mobilization: Blood, 1994; 84(6); 1737-46, pmid: 7521686
27. Alves-Filho JC, de Freitas A, Spiller F, The role of neutrophils in severe sepsis: Shock, 2008; 30(Suppl 1); 3-9, pmid: 18704017
28. Hotchkiss RS, Coopersmith CM, Karl IE, Prevention of lymphocyte apoptosis – a potential treatment of sepsis?: Clin Infect Dis, 2005; 41(Suppl 7); S465-69, pmid: 16237649
29. Bloos F, Reinhart K, Rapid diagnosis of sepsis: Virulence, 2014; 5(1); 154-60, pmid: 24335467
30. Silman NJ, Rapid diagnosis of sepsis using biomarker signatures: Crit Care, 2013; 17(6); 1020, pmid: 24314350
31. Moscovitz H, Shofer F, Mignott H, Plasma cytokine determinations in emergency department patients as a predictor of bacteremia and infectious disease severity: Crit Care Med, 1994; 22(7); 1102-7, pmid: 8026198
32. Chiesa C, Pellegrini G, Panero A, C-reactive protein, interleukin-6, and procalcitonin in the immediate postnatal period: influence of illness severity, risk status, antenatal and perinatal complications, and infection: Clin Chem, 2003; 49(1); 60-68, pmid: 12507961
33. Mehanic S, Baljic R, The importance of serum procalcitonin in diagnosis and treatment of serious bacterial infections and sepsis: Mater Sociomed, 2013; 25(4); 277-81, pmid: 24511275
34. Biju PG, Garg S, Wang WZ, Procalcitonin as a Predictive Biomarker for Total Body Irradiation-Induced Bacterial Load and Lethality in Mice: Shock, 2012; 38(2); 170-76, pmid: 22576002
35. Kotoula A, Gardikis S, Tsalkidis A, Comparative efficacies of procalcitonin and conventional inflammatory markers for prediction of renal parenchymal inflammation in pediatric first urinary tract infection: Urology, 2009; 73(4); 782-86, pmid: 19152962
36. Morgenthaler NG, Struck J, Chancerelle Y, Production of procalcitonin (PCT) in non-thyroidal tissue after LPS injection: Horm Metab Res, 2003; 35(5); 290-95, pmid: 12915998
37. Chan YL, Tseng CP, Tsay PK, Procalcitonin as a marker of bacterial infection in the emergency department: an observational study: Crit Care, 2004; 8(1); R12-20, pmid: 14975050
38. Hausfater P, Garric S, Ayed SB, Usefulness of procalcitonin as a marker of systemic infection in emergency department patients: a prospective study: Clin Infect Dis, 2002; 34(7); 895-901, pmid: 11880953
39. Gentili A, Iannella E, Giuntoli L, Baroncini S, System for predicting outcome and for clinical evaluation in sepsis and septic shock: could scores and biochemical markers be of greater help in the future?: Med Sci Monit, 2006; 12(6); LE11-12, pmid: 16733490
40. Nelson GE, Mave V, Gupta A, Biomarkers for sepsis: a review with special attention to India: BioMed Res Int, 2015; 2114; 264-351
41. Pierrakos C, Vincent JL, Sepsis biomarkers: a review: Crit Care, 2010; 14(1); R15, pmid: 20144219
42. Dong Q, Wright JR, Expression of C-reactive protein by alveolar macrophages: J Immunol, 1996; 156(12); 4815-20, pmid: 8648129
43. Jincharadze N, Abelashvili D, McHedlishvili M, Kacharava M, Diagnostic value of C-reactive protein test at early-onset sepsis in preterm infants: Georgian Med News, 2006; 130; 87-91, pmid: 16510922
44. Kubler A, Mayzner-Zawadzka E, Durek G, Results of severe sepsis treatment program using recombinant human activated protein C in Poland: Med Sci Monit, 2006; 12(3); CR107-12, pmid: 16501420
45. Ozturk E, Demirbilek S, Begec Z, Does leflunomide attenuate the sepsis-induced acute lung injury?: Pediatr Surg Int, 2008; 24(8); 899-905, pmid: 18516612
46. Martin G, Brunkhorst FM, Janes JM, The international PROGRESS registry of patients with severe sepsis: drotrecogin alfa (activated) use and patient outcomes: Crit Care, 2009; 13(3); R103, pmid: 19566927
47. Runcie C, Ramsay G, Intraabdominal infection: pulmonary failure: World J Surg, 1990; 14(2); 196-203, pmid: 2183482
48. Oberholzer A, Oberholzer C, Minter RM, Moldawer LL, Considering immunomodulatory therapies in the septic patient: should apoptosis be a potential therapeutic target?: Immunol Lett, 2001; 75(3); 221-24, pmid: 11166379
In Press
Clinical Research
Combined Fibrinogen and Urinary α1-Microglobulin as Predictors of Respiratory Tract Infection in Children w...Med Sci Monit In Press; DOI: 10.12659/MSM.951066
Database Analysis
Evaluation of Salivary Total Oxidant Status (TOS) and Total Antioxidant Status (TAS) in Orthodontic Patient...Med Sci Monit In Press; DOI: 10.12659/MSM.952052
Clinical Research
Presence and Impact of Fatigue in Patients With Multiple SclerosisMed Sci Monit In Press; DOI: 10.12659/MSM.953344
Clinical Research
Levofloxacin-Induced Cutaneous Adverse Reactions: Characteristics and Rational Use StrategiesMed Sci Monit In Press; DOI: 10.12659/MSM.951518
Most Viewed Current Articles
17 Jan 2024 : Review article 14,175,746
Vaccination Guidelines for Pregnant Women: Addressing COVID-19 and the Omicron VariantDOI :10.12659/MSM.942799
Med Sci Monit 2024; 30:e942799
13 Nov 2021 : Clinical Research 3,757,029
Acceptance of COVID-19 Vaccination and Its Associated Factors Among Cancer Patients Attending the Oncology ...DOI :10.12659/MSM.932788
Med Sci Monit 2021; 27:e932788
14 Dec 2022 : Clinical Research 2,466,013
Prevalence and Variability of Allergen-Specific Immunoglobulin E in Patients with Elevated Tryptase LevelsDOI :10.12659/MSM.937990
Med Sci Monit 2022; 28:e937990
16 May 2023 : Clinical Research 708,680
Electrophysiological Testing for an Auditory Processing Disorder and Reading Performance in 54 School Stude...DOI :10.12659/MSM.940387
Med Sci Monit 2023; 29:e940387






