02 February 2015: Molecular Biology
MiR-429 Inhibits Oral Squamous Cell Carcinoma Growth by Targeting ZEB1
Wanke Lei BCD , Yun-e Liu BF , Yuzhu Zheng EF , Lin Qu AG
DOI: 10.12659/MSM.893412
Med Sci Monit 2015; 21:383-389
Abstract
BACKGROUND: Oral squamous cell carcinoma (OSCC) is the sixth most common human malignancy worldwide. To develop new therapeutics requires elucidation of the underlying mechanism of OSCC pathogenesis. The role of miR-429 in OSCC remains unknown.
MATERIAL AND METHODS: The level of miR-429 and ZEB1 in OSCC tissues and cell lines was measured by qRT-PCR. MiR-429 was down-regulated by miRNAs antisense oligonucleotides (ASO) transfection and up-regulated by miRNAs mimics. Cell proliferation was analyzed by MTT assay. Cell apoptosis was revealed by FACS analysis. Targeted genes were predicted by a bioinformatics algorithm and confirmed by a dual luciferase reporter assay.
RESULTS: MiR-429 was down-regulated in OSCC tissues, and miR-429 overexpression inhibited OSCC cell lines growth and vice versa. Further, we found that miR-429 could inhibit zinc finger E-boxbinding homeobox 1 (ZEB1) expression, and that miR-429 and ZEB1 expression in OSCC tissues were negatively correlated.
CONCLUSIONS: Our data demonstrate the tumor suppressor role of miR-429 in OSCC, and may provide a potential therapeutic target that warrants further investigation.
Keywords: Algorithms, Carcinoma, Squamous Cell - metabolism, Cell Separation, Computational Biology, Homeodomain Proteins - metabolism, Mouth Neoplasms - metabolism, Oligonucleotides, Antisense - chemistry, Transcription Factors - metabolism
Background
Oral squamous cell carcinoma (OSCC) is a significant global disease and is the sixth most common human malignancy worldwide. Importantly, the incidence rate is increasing, especially in younger people [1,2]. Although the incidence of OSCC accounts for only 3% of all cases of cancer worldwide, this disease is considered a critical public health threat due the relatively low survival compared to the major cancers [3]. In China, over 11,900 cases of oral cancers are diagnosed each year and approximately 5,000 patients die of the disease [4]. A number of factors are associated with the increase of risks of oral cancer. The risk factors include age, tobacco and alcohol consumption, human papilloma virus infection, and race [5–7]. OSCC carcinogenesis occurs by a multistep process in which gene mutation or modifications were accumulated [8]. Although many molecules involved in the OSCC pathogenesis have been identified, the 5-year survival rate of OSCC remains very low [9]. The development of new therapies requires elucidation of the underlying mechanism of OSCC pathogenesis.
MicroRNAs (miRNAs) are a class of endogenous, non-coding, single-stranded, small regulatory RNA molecules, which are approximately 22 nucleotides in length [10]. MiRNAs inhibit translation and cleave mRNA by base-pairing to the 3′ untranslated region of the target genes [11–13]. Deregulation or dysfunction of miRNAs contributes to cancer development [14–19]. In OSCC, for example, down-regulation of miR-375 promoted proliferation via MYC protein [20], and decreased expression of miR-125b and miR-100 in oral cancer cells contributes to malignancy [21].
A previous study suggested that miR-429 may be involved in the pathogenesis of OSCC [22]. MiR-429 belongs to the miR-200 family, which plays a very important role in epithelial-mesenchymal transition (EMT) [23]. Another study revealed that miR-429 up-regulation induces apoptosis and suppresses invasion by targeting Bcl-2 and SP-1 in esophageal carcinoma [24].
In this study, we focused on the role of miR-429 in OSCC. We found that miR-429 could inhibit OSCC cell lines growth, and revealed the gene which miR-429 targeted. We hope that the results of this study will be useful in further investigation of OSCC pathogenesis and provide a potential therapeutic target.
Material and Methods
PATIENTS AND SAMPLE:
Surgical specimens from 66 PDAC OSCC patients and matched tumor-adjacent normal oral tissues were obtained postoperatively from 2006 onward from the Department of Oral and Maxillofacial Surgery, West China College of Stomatology, Sichuan University (Chengdu, China). All patients gave signed, informed consent for their tissues to be used for scientific research. Ethics approval for the study was obtained from West China Hospital, Sichuan University (Chengdu, China). All diagnoses were based on pathological and/or cytological evidence. The histological features of the specimens were evaluated by senior pathologists according to the World Health Organization classification criteria. Tissues were obtained prior to chemotherapy and radiotherapy and were immediately frozen and stored at −80°C prior to qRT-PCR assay. Matched tumor-adjacent normal tissues were used as control.
CELL CULTURE AND REAGENT:
HEK293, SCC-25, and CAL27 were obtained from the Cell Bank of the Chinese Academy of Science (Shanghai, China) and cultured in DMEM medium (Hyclone, South Logan, UT, USA) supplemented with 10% fetal bovine serum (Hyclone), 2 mM L-glutamine, and 100 μg/mL penicillin/streptomycin (Bio Light, Shanghai, China) as described in previous studies [25,26].
QUANTITATIVE REAL-TIME PCR (QRT-PCR):
The qRT-PCR analysis for miR-429 was performed by Shengong Company (Shanghai) using standard protocols on an Applied Biosystem’s 7500 HT sequence detection system. This assay includes a reverse-transcription step performed using a High-Capacity Complementary DNA Archive Kit (Applied Biosystems), in which a stem-loop reverse-transcription primer specifically hybridizes with an miRNA and then is reverse-transcribed with MultiScribe reverse transcriptase. miR-429 expression was assessed using a mirVana™ qRT-PCR miRNA Detection Kit (Ambion, USA). The following primers were designed and synthesized by Shengong Company (Shanghai, China): MiR-429 sense strand UAAUACUGUCUGGUAAAACCGU; miR-429 antisense strand CAAGAUCGGAUCUACGGGUUUU; NC sense strand UUCUCCGAACGUGUCACGUTT; and NC antisense strand ACGUGACACGUUCGGAGAATT. MiRNA-U6 was used as an internal control.
MTT ASSAY:
For MTT assay, 5×103 cells per well were seeded in triplicate in a 96-well plate with complete growth medium. The viability of the cells was measured over a period of 5 days using the MTT assay (Promega, Fitchburg, WI, USA) as described previously [17,27,28]. The data were read by Microtiter plate reader 570-nm filters (Promega, Fitchburg, WI, USA).
:
MiRNA targets were predicted using the following algorithms: TargetScan (https://www.targetscan.org) [33], miRand (http://www.cbio.mskcc.org/mirnaviewer) [29], PicTar (http://pictar.mdc-berlin.de) [34], miRGen [35,36], and miRBase (http://www.mirbase.org) [37]. The algorithm produced a list of hundreds of target genes for miRNAs by searching for the presence of conserved 8-mer and 7-mer sites matching the seed region of miRNAs.
MIRNA, PLASMID AND TRANSFECTION:
MiR-429 mimics, negative control miRNAs, and miR-429 antisense oligonucleotides (miR-429 ASO) were obtained from GenePharma (GenePharma, China). Plasmids were constructed by Genema (Genema, Shanghai). The mutant reporter plasmids were constructed using the QuikChange Mutagenesis Kit (Stratagene, La Jolla, CA). Cells were transfected with synthetic miR-429 (mimics) (Genema, Shanghai), pre-miR-429, negative control (NC), or pcDNA3.1-
LUCIFERASE REPORTER ASSAY:
The 3′UTR fragments of ZEB1 containing putative binding sites for miR-429 were cloned into pMIR-Report construct (Ambion, Austin, TX). The primers were constructed by Biomart (Shanghai, China) according to previous publications [38,39] and the details are provided in previous papers [39,40]. Mutant 3′UTR of ZEB1, which carried a mutated sequence in the complementary site for the seed region of miR-429, was generated using the fusion PCR method. Luciferase reporter assay was performed in HEK293 cells as described previously [41].
WESTERN BLOT AND ANTIBODIES:
Tumor tissues were collected, lysed, and blotted as described previously [16]. Membranes were blocked with blocking solution (5% skim milk in TBST) and incubated with primary antibody, followed by the incubation with appropriate HRP-conjugated secondary antibody. The ZEB1 antibody (anti-ZEB1) was purchased from Santa Cruz Biotechnology, Inc [42]. The densitometry of Western blot results was measured using ImageJ software.
STATISTICAL ANALYSIS:
Data are presented as the mean ±sd from at least three independent experiments. The difference between the groups was analyzed using two-tailed Student’s
Results
EXPRESSION OF MIR-429 IN OSCC TISSUES:
Initially, we collected 66 pairs of OSCC and its matched tumor-adjacent normal oral tissues. Then these tissues were analyzed by qRT-PCR for the miR-429 level. We found that in 52 pairs of pairs of OSCC and its matched tumor-adjacent normal oral tissues, miR-429 level in OSCC tissue were lower than in its matched tumor-adjacent normal oral tissues (Figure 1A) and the mean level of miR-429 was lower in OSCC tissues than in matched tumor-adjacent normal oral tissues (Figure 1B). These data indicate that miR-429 may play a role in the pathogenesis of OSCC.
MIR-429 OVEREXPRESSION INHIBITED OSCC CELL LINES GROWTH:
To further investigate the role of miR-429 in OSCC, we firstly measured the miR-429 level in two OSCC cell lines – SCC-25 and CAL27. We found that the miR-429 levels in SCC-25 and CAL27 were lower in than in normal oral tissues and HEK293 cell line (Figure 2A). Then, we up-regulated the miR-429 level in SCC-25 and CAL27 by miR-429 mimics transfection. The effectiveness of transfection was verified by qRT-PCR (Figure 2B). After miR-429 mimics transfection, cellular proliferation was assayed by MTT assay, and we found that up-regulation of miR-429 inhibited SCC-25 and CAL27 proliferation (Figure 2C).
DOWN-REGULATION OF MIR-429 PROMOTED OSCC CELL LINES GROWTH:
We then down-regulated the miR-429 level in SCC-25, CAL27, and HEK293 cell lines by transfecting with miR-429 ASO. The level of miR-429 in the three cell lines was assayed by qRT-PCR 48 h after transfection and we found miR-429 ASO transfection down-regulated the miR-429 level in the three cell lines (Figure 3A). Then the cellular proliferation was assayed by MTT assay. We found that miR-429 ASO transfection mildly promoted cells growth in SCC-25 and CAL27 and greatly promoted cells growth in HEK293 cell lines (Figure 3B).
ZEB1 WAS TARGETED BY MIR-429:
Epithelial-mesenchymal transition (EMT) is a critical step in tumor cell invasion and metastasis, and correlates positively with poor patient prognosis [43,44]. E-cadherin transcriptional repressors, ZEB1, are the EMT-inducing transcriptional factors. ZEB1 repress E-cadherin expression and promote cancer cell migration and invasion [45–48]. Previous studies have shown that EMT is also a critical step of the pathogenesis of OSCC [49], and clinically, the level of ZEB1 expression was higher in recurrent OSCC tumor samples but lower in primary lesions [50]. The bioinformatics algorithm predicted that ZEB1 was a potential target gene of miR-429. The five binding sites and mutated sites in ZEB1 are shown in Figure 4A. To confirm that ZEB1 was a potential target gene of miR-429 and the miRNA-target interaction, five binding sites in the 3′UTR of ZEB1and its mutated version were cloned into luciferase reporter plasmids. MiR-429 mimics and the reporter plasmids were co-transfected into HEK293 cells. We found that in wild type 3′ UTR, miR-429 mimics reduced the luciferase activity; however, in the mutated version, the mutated binding site partly restored the luciferase activity and the five mutated binding sites almost restored the luciferase activity (Figure 4B). Next, we transfected CAL27 cell line with miR-429 mimics; 48 h later, the data from Western blot analysis showed that the ZEB1 protein level was inhibited (Figure 4C). Further, the ZEB1 mRNA expression in the 66 OSCC tissues were examined by qRT-PCR, and we found that ZEB1 mRNA level and miR-429 level were negative correlated (Figure 4D).Therefore, our results show that miR-429 plays a role in OSCC via ZEB1.
Discussion
Our results show that miR-429 expression is lower in OSCC tissues than in normal control oral tissues. MiR-429 overexpression inhibited OSCC cell lines growth and vice versa. 3′UTR of ZEB1 was targeted by miR-429. Therefore, we conclude that the low miR-429 level in OSCC promoted tumor cells growth.
Our data highlights the role of miR-429 in the growth of OSCC cells. Our study may be the first to reveal the role of miR-429 in OSCC. Previously, miR-429 was shown to have two different roles in cancer. In most cancers, miR-429 level is down-regulated [51,52], which agrees with our data. In endometrial carcinoma and bladder cancer, miR-429 level was up-regulated [53,54]. Higher expression levels of miR-429 are correlated with a poor prognosis in patients with serious ovarian carcinoma [55]. In hepatocellular carcinoma, miR-429 plays the role of an oncogene, is overexpressed in liver cancer tissues, and can be considered as a potential prognostic factor for HCC. Furthermore, overexpression of this miR-429 promoted proliferation and inhibited apoptosis in liver cancer cells [56].The different roles of miR-429 are possibly due to the fact that miRNAs can down-regulate numerous targets, including oncogenes and tumor suppressor genes. A previous study proved that miR-429 could not only inhibit the proliferation of osteosarcoma cell lines, but also induce more cell apoptosis. MiR-429 plays its role in osteosarcoma by binding the 3′UTR of
Our data show that
Conclusions
In conclusion, our data proves that low miR-429 level and in OSCC tissues promotes tumor cell growth. MiR-429 exerts its role by targeting ZEB1. We anticipate the results of our study will provide useful information and be a basis for further studies.
Reference
1. Siegel R, Ma J, Zou Z, Jemal A, Cancer statistics, 2014: Cancer J Clin, 2014; 64(1); 9-29
2. Siegel R, Naishadham D, Jemal A, Cancer statistics, 2013: Cancer J Clin, 2013; 63(1); 11-30
3. Messadi DV, Wilder-Smith P, Wolinsky L, Improving oral cancer survival: the role of dental providers: J Calif Dent Assoc, 2009; 37(11); 789-98, pmid: 19998655
4. Han S, Chen Y, Ge X, Epidemiology and cost analysis for patients with oral cancer in a university hospital in China: BMC Public Health, 2010; 10; 196, pmid: 20398380
5. Kademani D, Oral cancer: Mayo Clin Proc, 2007; 82(7); 878-87, pmid: 17605971
6. Laronde DM, Hislop TG, Elwood JM, Rosin MP, Oral cancer: just the facts: J Can Dent Assoc, 2008; 74(3); 269-72, pmid: 18387267
7. Schwartz SM, Daling JR, Doody DR, Oral cancer risk in relation to sexual history and evidence of human papillomavirus infection: J Natl Cancer Inst, 1998; 90(21); 1626-36, pmid: 9811312
8. Lippman SM, Sudbo J, Hong WK, Oral cancer prevention and the evolution of molecular-targeted drug development: J Clin Oncol, 2005; 23(2); 346-56, pmid: 15637397
9. Jemal A, Bray F, Center MM, Global cancer statistics: Cancer J Clin, 2011; 61(2); 69-90
10. Ambros V, microRNAs: tiny regulators with great potential: Cell, 2001; 107(7); 823-26, pmid: 11779458
11. Kim VN, Han J, Siomi MC, Biogenesis of small RNAs in animals: Nat Rev Mol Cell Biol, 2009; 10(2); 126-39, pmid: 19165215
12. Bartel DP, MicroRNAs: target recognition and regulatory functions: Cell, 2009; 136(2); 215-33, pmid: 19167326
13. Valencia-Sanchez MA, Liu J, Hannon GJ, Parker R, Control of translation and mRNA degradation by miRNAs and siRNAs: Genes Dev, 2006; 20(5); 515-24, pmid: 16510870
14. Garzon R, Calin GA, Croce CM, MicroRNAs in Cancer: Annu Rev Med, 2009; 60; 167-79, pmid: 19630570
15. Ambros V, The functions of animal microRNAs: Nature, 2004; 431(7006); 350-55, pmid: 15372042
16. Hou J, Lin L, Zhou W, Identification of miRNomes in human liver and hepatocellular carcinoma reveals miR-199a/b-3p as therapeutic target for hepatocellular carcinoma: Cancer Cell, 2011; 19(2); 232-43, pmid: 21316602
17. Liu C, Li B, Cheng Y, MiR-21 plays an important role in radiation induced carcinogenesis in BALB/c mice by directly targeting the tumor suppressor gene Big-h3: Int J Biol Sci, 2011; 7(3); 347-63, pmid: 21494432
18. Mendell JT, Olson EN, MicroRNAs in stress signaling and human disease: Cell, 2012; 148(6); 1172-87, pmid: 22424228
19. Croce CM, Causes and consequences of microRNA dysregulation in cancer: Nat Rev Genet, 2009; 10(10); 704-14, pmid: 19763153
20. Jung HM, Patel RS, Phillips BL, Tumor suppressor miR-375 regulates MYC expression via repression of CIP2A coding sequence through multiple miRNA-mRNA interactions: Mol Biol Cell, 2013; 24(11); 1638-48, pmid: 23552692
21. Henson BJ, Bhattacharjee S, O’Dee DM, Decreased expression of miR-125b and miR-100 in oral cancer cells contributes to malignancy: Genes Chromosomes Cancer, 2009; 48(7); 569-82, pmid: 19396866
22. Wiklund ED, Gao S, Hulf T, MicroRNA alterations and associated aberrant DNA methylation patterns across multiple sample types in oral squamous cell carcinoma: PloS One, 2011; 6(11); e27840, pmid: 22132151
23. Mongroo PS, Rustgi AK, The role of the miR-200 family in epithelial-mesenchymal transition: Cancer Biol Ther, 2010; 10(3); 219-22, pmid: 20592490
24. Wang Y, Li M, Zang W, MiR-429 up-regulation induces apoptosis and suppresses invasion by targeting Bcl-2 and SP-1 in esophageal carcinoma: Cell Oncol, 2013; 36(5); 385-94
25. Wu N, Liu C, Bai C, Over-Expression of Deubiquitinating Enzyme USP14 in Lung Adenocarcinoma Promotes Proliferation through the Accumulation of beta-Catenin: Int J Mol Sci, 2013; 14(6); 10749-60, pmid: 23702845
26. Wu N, Zhang C, Bai C, MiR-4782-3p inhibited non-small cell lung cancer growth via USP14: Cell Physiol Biochem, 2014; 33(2); 457-67, pmid: 24556800
27. van Meerloo J, Kaspers GJ, Cloos J, Cell sensitivity assays: the MTT assay: Methods Mol Biol, 2011; 731; 237-45, pmid: 21516412
28. Han ZB, Yang Z, Chi Y, MicroRNA-124 suppresses breast cancer cell growth and motility by targeting CD151: Cell Physiol Biochem, 2013; 31(6); 823-32, pmid: 23816858
29. John B, Enright AJ, Aravin A, Human MicroRNA targets: PLoS Biol, 2004; 2(11); e363, pmid: 15502875
30. Krek A, Grun D, Poy MN, Combinatorial microRNA target predictions: Nat Genet, 2005; 37(5); 495-500, pmid: 15806104
31. Ma Q, Jiang Q, Pu Q, MicroRNA-143 inhibits migration and invasion of human non-small-cell lung cancer and its relative mechanism: Int J Biol Sci, 2013; 9(7); 680-92, pmid: 23904792
32. Zhou BR, Guo XF, Zhang JA, Elevated miR-34c-5p mediates dermal fibroblast senescence by ultraviolet irradiation: Int J Biol Sci, 2013; 9(7); 743-52, pmid: 23983607
33. Coronnello C, Benos PV, ComiR: Combinatorial microRNA target prediction tool: Nucleic Acids Res, 2013; 41(Web Server issue); W159-64, pmid: 23703208
34. Lewis BP, Shih IH, Jones-Rhoades MW, Prediction of mammalian microRNA targets: Cell, 2003; 115(7); 787-98, pmid: 14697198
35. Megraw M, Sethupathy P, Corda B, Hatzigeorgiou AG, miRGen: a database for the study of animal microRNA genomic organization and function: Nucleic Acids Res, 2007; 35(Database issue); D149-55, pmid: 17108354
36. Alexiou P, Vergoulis T, Gleditzsch M, miRGen 2.0: a database of microRNA genomic information and regulation: Nucleic Acids Res, 2010; 38(Database issue); D137-41, pmid: 19850714
37. Griffiths-Jones S, Saini HK, van Dongen S, Enright AJ, miRBase: tools for microRNA genomics: Nucleic Acids Res, 2008; 36(Database issue); D154-58, pmid: 17991681
38. Bendoraite A, Knouf EC, Garg KS, Regulation of miR-200 family microRNAs and ZEB transcription factors in ovarian cancer: evidence supporting a mesothelial-to-epithelial transition: Gynecol Oncol, 2010; 116(1); 117-25, pmid: 19854497
39. Gregory PA, Bert AG, Paterson EL, The miR-200 family and miR-205 regulate epithelial to mesenchymal transition by targeting ZEB1 and SIP1: Nat Cell Biol, 2008; 10(5); 593-601, pmid: 18376396
40. Liu X, Liu Y, Wu S, Tumor-suppressing effects of miR-429 on human osteosarcoma: Cell Biochem Biophys, 2014; 70(1); 215-24, pmid: 24633485
41. Li D, Liu X, Lin L, MicroRNA-99a inhibits hepatocellular carcinoma growth and correlates with prognosis of patients with hepatocellular carcinoma: J Biol Chem, 2011; 286(42); 36677-85, pmid: 21878637
42. Reilly SM, Chiang SH, Decker SJ, An inhibitor of the protein kinases TBK1 and IKK-varepsilon improves obesity-related metabolic dysfunctions in mice: Nat Med, 2013; 19(3); 313-21, pmid: 23396211
43. Hugo H, Ackland ML, Blick T, Epithelial – mesenchymal and mesenchymal – epithelial transitions in carcinoma progression: J Cell Physiol, 2007; 213(2); 374-83, pmid: 17680632
44. Thiery JP, Epithelial-mesenchymal transitions in tumour progression: Nat Rev Cancer, 2002; 2(6); 442-54, pmid: 12189386
45. Comijn J, Berx G, Vermassen P, The two-handed E box binding zinc finger protein SIP1 downregulates E-cadherin and induces invasion: Mol Cell, 2001; 7(6); 1267-78, pmid: 11430829
46. Shirakihara T, Saitoh M, Miyazono K, Differential regulation of epithelial and mesenchymal markers by deltaEF1 proteins in epithelial mesenchymal transition induced by TGF-beta: Mol Biol Cell, 2007; 18(9); 3533-44, pmid: 17615296
47. Spaderna S, Schmalhofer O, Wahlbuhl M, The transcriptional repressor ZEB1 promotes metastasis and loss of cell polarity in cancer: Cancer Res, 2008; 68(2); 537-44, pmid: 18199550
48. Vandewalle C, Comijn J, De Craene B, SIP1/ZEB2 induces EMT by repressing genes of different epithelial cell-cell junctions: Nucleic Acids Res, 2005; 33(20); 6566-78, pmid: 16314317
49. Zuo JH, Zhu W, Li MY, Activation of EGFR promotes squamous carcinoma SCC10A cell migration and invasion via inducing EMT-like phenotype change and MMP-9-mediated degradation of E-cadherin: J Cell Biochem, 2011; 112(9); 2508-17, pmid: 21557297
50. Ho CM, Hu FW, Lee SS, ZEB1 as an indicator of tumor recurrence for areca quid chewing-associated oral squamous cell carcinomas: J Oral Pathol Med, 2014 [Epub ahead of print]
51. Calin GA, Croce CM, MicroRNA signatures in human cancers: Nat Rev Cancer, 2006; 6(11); 857-66, pmid: 17060945
52. Mattick JS, Makunin IV, Small regulatory RNAs in mammals: Hum Mol Genet, 2005; 14(Spec 1); R121-32, pmid: 15809264
53. Tavazoie SF, Alarcon C, Oskarsson T, Endogenous human microRNAs that suppress breast cancer metastasis: Nature, 2008; 451(7175); 147-52, pmid: 18185580
54. Tie J, Fan D, Big roles of microRNAs in tumorigenesis and tumor development: Histol Histopathol, 2011; 26(10); 1353-61, pmid: 21870338
55. Uhlmann S, Zhang JD, Schwager A, miR-200bc/429 cluster targets PLCgamma1 and differentially regulates proliferation and EGF-driven invasion than miR-200a/141 in breast cancer: Oncogene, 2010; 29(30); 4297-306, pmid: 20514023
56. Huang XY, Yao JG, Huang HD, MicroRNA-429 Modulates Hepatocellular Carcinoma Prognosis and Tumorigenesis: Gastroenterol Res Pract, 2013; 2013; 804128, pmid: 24204382
In Press
Clinical Research
Nasal Mucociliary Clearance and Its Relationship With Disease Severity in Patients With Multiple SclerosisMed Sci Monit In Press; DOI: 10.12659/MSM.952850
Clinical Research
Modified Thoracoabdominal Nerves Block Through the Perichondrial Approach vs Subcostal Transversus Abdomini...Med Sci Monit In Press; DOI: 10.12659/MSM.953976
Clinical Research
Establishment of a Novel Approach for Drug Abuse Monitoring and Its Application in Medical InstitutionsMed Sci Monit In Press; DOI: 10.12659/MSM.952054
Database Analysis
Epidemiology of Incidence and Mortality Due to Head and Neck Cancer in Poland in 2000 to 2022Med Sci Monit In Press; DOI: 10.12659/MSM.952477
Most Viewed Current Articles
17 Jan 2024 : Review article 14,176,622
Vaccination Guidelines for Pregnant Women: Addressing COVID-19 and the Omicron VariantDOI :10.12659/MSM.942799
Med Sci Monit 2024; 30:e942799
13 Nov 2021 : Clinical Research 3,763,552
Acceptance of COVID-19 Vaccination and Its Associated Factors Among Cancer Patients Attending the Oncology ...DOI :10.12659/MSM.932788
Med Sci Monit 2021; 27:e932788
14 Dec 2022 : Clinical Research 2,466,355
Prevalence and Variability of Allergen-Specific Immunoglobulin E in Patients with Elevated Tryptase LevelsDOI :10.12659/MSM.937990
Med Sci Monit 2022; 28:e937990
16 May 2023 : Clinical Research 708,950
Electrophysiological Testing for an Auditory Processing Disorder and Reading Performance in 54 School Stude...DOI :10.12659/MSM.940387
Med Sci Monit 2023; 29:e940387






