12 June 2015: Clinical Research
Polymorphisms in NFKB1 and NFKBIA Genes Modulate the Risk of Developing Prostate Cancer among Han Chinese
Xiao Han BCEG , Jia-jun Zhang BCDG , Nan Yao BCFG , Gang Wang AFG , Juan Mei EFG , Bo Li BCEG , Chao Li CDG , Zi-an Wang AEG
DOI: 10.12659/MSM.893471
Med Sci Monit 2015; 21:1707-1715
Abstract
BACKGROUND: Nuclear factor kappa B (NF-κB) pathway proteins play an important role in modulating inflammation and other carcinogenic processes. Polymorphisms within NF-κB pathway genes may influence cancer risk. This study aimed to examine the association between NFKB19-4 ATTG ins→del, NFKBIA 3’ UTR A→G, -826CT and -881AG polymorphisms and prostate cancer risk among Chinese.
MATERIAL AND METHODS: The polymorphisms were genotyped via PCR-RFLP technique on 936 prostate cancer patients and 936 population-based healthy controls. Logistic regression model was used to measure the risk association present.
RESULTS: With the exception of NFKBIA 3’ UTR polymorphism, the heterozygous and mutant genotypes of the other polymorphisms were significantly associated with prostate cancer risk. For NFKB1 polymorphism, a decreased risk was observed, with adjusted OR: 0.69; 95% CI: 0.44, 0.98; P=0.01 (heterozygous) and adjusted OR: 0.60; 95% CI: 0.37, 0.91; P=0.02 (mutant). NFKBIA -826CT and -881AG polymorphisms were in complete linkage disequilibrium and shared the same risk association, with adjusted OR: 1.34; 95% CI: 1.09, 1.62; P=0.02 (heterozygous) and adjusted OR: 2.83; 95% CI: 1.79, 4.50; P=0.01 (mutants). Interestingly, the impact of the NFKB1 polymorphism was not present in nonsmokers and younger (<60 years) subjects (P<0.05).
CONCLUSIONS: In conclusion, polymorphisms in NFKB1 and NFKBIA genes may modulate the risk of developing prostate cancer among Chinese.
Keywords: Case-Control Studies, Asian Continental Ancestry Group - genetics, Genetic Association Studies, Genetic Predisposition to Disease, I-kappa B Proteins - genetics, NF-kappa B p50 Subunit - genetics, Polymerase Chain Reaction, Polymorphism, Genetic, Polymorphism, Restriction Fragment Length, Prostatic Neoplasms - genetics
Background
Prostate cancer is a common type of cancer in men, with an estimated annual incidence of 238,590 cases [1]. Although most of the prostate cancer cases happen in the developed countries, recent years have witnessed the rapid increase in prostate cancer incidence in developing populations, including China [2]. Prostate cancer is also one of the leading causes of cancer-related mortality, accounting for 10% of all male cancer-related deaths, in both Western and Asian populations [3]. Considering the significance of the disease, there is a pressing need for identifying risk factors of prostate cancer, so that the disease can be detected at an early stage, which facilitates prostate cancer treatment and management.
The mechanism of prostate carcinogenesis is extremely complicated. However, it has been generally accepted that the etiology of prostate cancer is influenced by several factors such as smoking habits, age, ethnicity, and, importantly, genetic factors [4–6]. It has been shown previously that the latter could contribute to up to 42% of prostate cancer risk [6]. Candidate gene association study (CGAS) is an established method for identifying genetic variants associated with a disease [7]. The approach focuses only on genes that could be of relevance to the mechanism of the disease of interest [7,8]. The specific polymorphisms that could either affect gene expression or the protein product of the chosen candidate genes were then selected. Subsequently, the frequencies of the polymorphic genotypes were compared between subjects with and without the disease, and statistical models were used to determine risk association [7,8].
Many studies on prostate carcinogenesis have focused on the role of genetic factors that mediate inflammatory response [9–12], as inflammation has been extensively linked to the etiology of prostate cancer, although other mechanisms such as cell adhesion also plays an important role [13,14]. Given the important role of inflammation in carcinogenesis, the present candidate gene association study focused on genes relevant to inflammation. Among all the proteins involved in inflammatory response, the nuclear factor-kappa B (NF-κB) pathway proteins, notably p50 (NF-κB1) and its critical inhibitor, IκBα, appeared to have the most important function. NF-κB activation can lead to the synthesis of several enzymes, including inducible nitric oxide synthase (iNOS) and cyclooxygenase-2, which catalyze the release of reactive oxygen species that damages adjacent cells. The NF-κB pathway has also been shown to regulate the production of many pro-inflammatory cytokines, such as TGF-β, TNF-α, IL-6, and IL-8, which further supports the role of NF-κB in inflammation. Inflammation causes various genomic lesions to the cells, which facilitates cancer development. Additionally, improper activation of NF-κB1 can cause enhanced cell proliferation and evasion of apoptosis, which are 2 of the cancer hallmarks. Therefore, under normal conditions, NF-κB1 is bound to IκBα inhibitor when its expression is not needed.
NF-κB1 and IκBα are encoded by
Material and Methods
SUBJECTS:
Between September 2008 and June 2014, 936 newly diagnosed, histopathologically confirmed sporadic prostate cancer patients were randomly recruited from the First Affiliated Hospital of Bengbu Medical College, Bengbu Third People’s Hospital, the Second Affiliated Hospital of Bengbu Medical College, the People’s Liberation Army 123rd Hospital China and Bengbu First People’s Hospital. Based on medical records, patients who had family history of prostate cancer and those who suffered from malignancies other than prostate cancer were excluded. Healthy males (N=936) were randomly recruited from the general population as controls. Controls were matched with patients by age (±5 years). The age of the patients recruited ranged from 50 to 76 years old, with a mean of 62.0±6.89 years. The controls’ ages ranged from 48 to 73 years old, with a mean of 61.4±7.11. Based on our previous preliminary findings (data not shown), the peak age of prostate cancer incidence in our population occurred at 60 years old. Therefore, subjects below 60 years old were categorized as “young”, while those 60 years or above were categorized as “old” in our analysis. 442 of the patients and 389 of the controls were smokers, while the rest were nonsmokers. Information on the subjects’ age was collected based on the medical registration form (which was in turn based on the official identity card of the People’s Republic of China). On the other hand, information on the smoking habits was obtained from an interview with subjects on recruitment. All subjects were self-described ethnic Han Chinese. They were asked to sign a written informed consent before donating 3 ml blood for genetic analysis. The study was approved by the Medical Ethics Board (MEB) of Bengbu Medical College (approval no. BMC/1/IMO/2008.0415504).
GENOTYPING OF POLYMORPHISMS:
DNA was extracted from blood samples by using the TIANGEN DNA Purification Kit. All polymorphisms were genotyped by previously described PCR-RFLP technique (NFKB1, [15]; NFKBIA 3′ UTR [21], NFKBIA -826CT, and -881AG [19]), with the researchers blinded to the case/control status of the samples. For NFKB1 polymorphism, the PCR primers were TGGGCACAAGTCGTTTATGA (forward) and CTGGAGCCGGTAGGGAAG (reverse), while the restriction enzyme used was PflMI (Van91I). For NFKBIA 3′ UTR polymorphism, the PCR primers were GGCTGAAAGAACATGGACTTG (forward) and GTACACCATTTACAGGAGGG (reverse), while HaeIII was used for the digesting the PCR products. NFKBIA -826CT and -881AG polymorphisms were amplified simultaneously by using GGTCCTTAAGGTCCAATCG (forward) and GTTGTGGATACCTTGCACTA (reverse). NFKBIA -826CT polymorphism was digested by using BfaI, and NFKBIA -881AG polymorphism was digested by using TspRI. Approximately 10% of randomly selected samples were sequenced to confirm the genotypes.
STATISTICAL ANALYSIS:
All analyses were performed by using SPSS version 17.0. Continuous variables were assessed by using the independent samples t-test and are presented as mean ±SD. Categorical variables were tested by using the chi-square test. The Hardy-Weinberg equilibrium was analyzed by using a goodness-of-fit chi-square test. An unconditional logistic regression model was performed to calculate the odds ratios (ORs) and their corresponding 95% confidence intervals (95% CI) to assess the association of the polymorphisms with prostate cancer risk. The overall ORs were also adjusted to age and smoking status of the subjects. A p-value <0.05 was statistically significant.
Results
:
The frequency of NFKB1 and NFKBIA genotypes in the 936 patients and 936 controls are shown in Table 1. Significant differences in genotype frequency were observed between patients and controls for the NFKB19-4 ATTG polymorphism (P=0.03), NFKBIA -826CT polymorphism (P<0.01), and NFKBIA -881AG polymorphism (P<0.01). The frequency for NFKBIA -826CT and -881AG polymorphisms was identical, indicating the presence of linkage disequilibrium (LD). In addition, the genotype frequency for all the polymorphisms followed Hardy-Weinberg Equilibrium (Table 1).
ASSOCIATION OF THE SNPS AND PROSTATE CANCER RISK:
Table 2 showed the association of the SNPs and prostate cancer risk. Significant association was found for NFKB19-4 ATTG, NFKBIA -826CT and -881AG polymorphisms, but not the NFKBIA 3′ UTR polymorphism. For NFKB19-4 ATTG polymorphism, the ins/del genotype and del/del genotype were associated with a lower prostate cancer risk, with adjusted OR: 0.69; 95% CI: 0.44, 0.98; P=0.01 and adjusted OR: 0.60; 95% CI: 0.37, 0.91; P=0.02 respectively. For NFKBIA -826CT and -881AG polymorphisms, a higher prostate cancer risk association was observed. Since both polymorphisms were in LD, they had an identical risk value, with adjusted OR: 1.34; 95% CI: 1.09, 1.62; P=0.02 for heterozygotes and adjusted OR: 2.83; 95% CI: 1.79, 4.50; P=0.01 for mutants.
:
Significant polymorphisms were evaluated for their combined effect on prostate cancer risk. The results are shown in Table 3. With the exceptions of NFKB19–4 ATTG ins/ins + NFKBIA mutant and NFKB19-4 ATTG ins/del + NFKBIA mutant combinative genotypes, all other genotypes were significantly associated with a lower prostate cancer risk (OR<1.00) (Table 3).
ASSOCIATION OF THE SNPS AND PROSTATE CANCER RISK IN PEOPLE WITH DIFFERENT SMOKING STATUS:
The association above was analyzed separately for smokers and nonsmokers. The result is shown in Table 4. For smokers, similar to the overall findings described above, significant association with prostate cancer risk was observed for NFKB19-4 ATTG, NFKBIA -826CT, and -881AG polymorphisms. However, for nonsmokers, the association of NFKB1 polymorphism was absent, and only NFKBIA -826CT and -881AG polymorphisms showed risk association.
For smokers, the del/del genotype of
ASSOCIATION OF THE SNPS AND PROSTATE CANCER RISK IN OLDER AND YOUNGER SUBJECTS:
We also analyzed the association based on the age of the subjects (old vs. young). Table 5 shows the association of the SNPs and prostate cancer risk in older and younger subjects. The finding based on age was similar to the finding based on the smoking status above, such that for older subjects, an association was observed for NFKB19-4 ATTG, NFKBIA -826CT, and -881AG polymorphisms, but for younger subjects the NFKB19-4 ATTG association was lost.
For older subjects, the del/del genotype of
Discussion
NF-κB pathway proteins play an important role in modulating inflammation and other related cellular processes. Among the many NF-κB pathway proteins, the most abundant p50 (NF-κB1) has been thought to have the most important function in these cellular processes [24–26]. Regulation of p50 (NF-κB1) by its natural inhibitor, IκBα, is necessary for the former to carry out its cellular functions. The p50 (NF-κB1) and IκBα proteins were encoded by
It has been well-established that many inflammatory-related cytokines, such as TGF-β, TNF-α, IL-6, and IL-8, mediate inflammation in the prostate through the NF-κB pathway [22,27–30]. Therefore, genes in the NF-κB pathway, notably
We also found that all combinative genotypes of
There were several strengths and limitations in this study. The greatest strength was the large sample size. The combined sample size of the only 2 available studies on NF-κB pathway gene polymorphism was 487 prostate cancer patients and 513 controls [22,23]. The present study alone involved 936 prostate cancer patients and 936 controls, which had a much higher statistical power than the other 2 studies combined. Another strength of this study was that we analyzed not only the overall effect of the polymorphism on prostate cancer risk, but also the effect in smokers
Conclusions
The del allele of the
References
1. Siegel R, Naishadham D, Jemal A, Cancer statistics, 2013: Cancer J Clin, 2013; 63(1); 11-30
2. McCracken M, Olsen M, Chen MS, Cancer incidence, mortality, and associated risk factors among Asian Americans of Chinese, Filipino, Vietnamese, Korean, and Japanese ethnicities: Cancer J Clin, 2007; 57(4); 190-205
3. Ferlay J, Soerjomataram I, Ervik M: GLOBOCAN 2012 v1.0, cancer incidence and mortality worldwide: IARC CancerBase No. 11 [Internet], 2013, Lyon, France, International Agency for Research on Cancer Available from: http://globocan.iarc.fr
4. Murphy AB, Akereyeni F, Nyame YA, Smoking and prostate cancer in a multi-ethnic cohort: Prostate, 2013; 73(14); 1518-28, pmid: 23824512
5. Leitzmann MF, Rohrmann S, Risk factors for the onset of prostatic cancer: age, location, and behavioral correlates: Clin Epidemiol, 2012; 4; 1-11, pmid: 22291478
6. Lichtenstein P, Holm NV, Verkasalo PK, Environmental and heritable factors in the causation of cancer – analyses of cohorts of twins from Sweden, Denmark, and Finland: N Engl J Med, 2000; 343(2); 78-85, pmid: 10891514
7. Patnala R, Clements J, Batra J, Candidate gene association studies: a comprehensive guide to useful in silico tools: BMC Genetics, 2013; 14; 39, pmid: 23656885
8. Kwon JM, Goate AM, The candidate gene approach: Alcohol Res Health, 2000; 24(3); 164-68, pmid: 11199286
9. Kryvenko ON, Jankowski M, Chitale DA, Inflammation and preneoplastic lesions in benign prostate as risk factors for prostate cancer: Mod Pathol, 2012; 25(7); 1023-32, pmid: 22460812
10. Sfanos KS, Isaacs WB, De Marzo AM, Infections and inflammation in prostate cancer: Am J Clin Exp Urol, 2013; 1(1); 3-11, pmid: 25110720
11. Sfanos KS, Hempel HA, De Marzo AM, The role of inflammation in prostate cancer: Adv Exp Med Biol, 2014; 816; 153-81, pmid: 24818723
12. Sfanos KS, De Marzo AM, Prostate cancer and inflammation: the evidence: Histopathology, 2012; 60(1); 199-215, pmid: 22212087
13. Wang L, Xie PG, Lin YL, Aberrant methylation of PCDH10 predicts worse biochemical recurrence-free survival in patients with prostate cancer after radical prostatectomy: Med Sci Monit, 2014; 20; 1363-68, pmid: 25086586
14. Lin YL, Xie PG, Wang L, Ma JG, Aberrant methylation of protocadherin 17 and its clinical significance in patients with prostate cancer after radical prostatectomy: Med Sci Monit, 2014; 20; 1376-82, pmid: 25091018
15. Mohd Suzairi MS, Tan SC, Ahmad Aizat AA: Cancer Epidemiol, 2013; 37(5); 634-38, pmid: 23806437
16. Shiels MS, Engels EA, Shi J, Genetic variation in innate immunity and inflammation pathways associated with lung cancer risk: Cancer, 2012; 118(22); 5630-36, pmid: 23044494
17. Cheng CW, Su JL, Lin CW, Effects of NFKB1 and NFKBIA gene polymorphisms on hepatocellular carcinoma susceptibility and clinicopathological features: PLoS One, 2013; 8(2); e56130, pmid: 23457512
18. Curran JE, Weinstein SR, Griffiths LR, Polymorphic variants of NFKB1 and its inhibitory protein NFKBIA, and their involvement in sporadic breast cancer: Cancer Lett, 2002; 188(1–2); 103-7, pmid: 12406554
19. Tan SC, Suzairi MS, Aizat AA, Gender-specific association of NFKBIA promoter polymorphisms with the risk of sporadic colorectal cancer: Med Oncol, 2013; 30(4); 693, pmid: 23996241
20. White KL, Vierkant RA, Phelan CM, Polymorphisms in NF-kappaB inhibitors and risk of epithelial ovarian cancer: BMC Cancer, 2009; 9; 170, pmid: 19500386
21. Shafi’i MSM, Shahpudin SNM, Mustapha MA, The genetic variation A>G at 3′ UTR of nuclear factor kappa B 1 A (NFκB1A) influences susceptibility of sporadic colorectal cancer in Malaysian population: Int Med J, 2012; 19(2); 98-101
22. Zhang P, Wei Q, Li X, A functional insertion/deletion polymorphism in the promoter region of the NFKB1 gene increases susceptibility for prostate cancer: Cancer Genet Cytogenet, 2009; 191(2); 73-77, pmid: 19446741
23. Kopp TI, Friis S, Christensen J, Polymorphisms in genes related to inflammation, NSAID use, and the risk of prostate cancer among Danish men: Cancer Genet, 2013; 206(7–8); 266-78, pmid: 23880210
24. Oeckinghaus A, Ghosh S, The NF-kappaB family of transcription factors and its regulation: Cold Spring Harb Perspect Biol, 2009; 1(4); a000034, pmid: 20066092
25. Tak PP, Firestein GS, NF-kappaB: a key role in inflammatory diseases: J Clin Invest, 2001; 107(1); 7-11, pmid: 11134171
26. Naugler WE, Karin M, NF-kappaB and cancer-identifying targets and mechanisms: Curr Opin Genet Dev, 2008; 18(1); 19-26, pmid: 18440219
27. Lu S, Dong Z, Characterization of TGF-beta-regulated interleukin-8 expression in human prostate cancer cells: Prostate, 2006; 66; 996-1004, pmid: 16541418
28. Wise GJ, Marella VK, Talluri G, Shirazian D, Cytokine variations in patients with hormone treated prostate cancer: J Urol, 2000; 164; 722-25, pmid: 10953133
29. Nakashima J, Tachibana M, Horiguchi Y, Serum interleukin 6 as a prognostic factor in patients with prostate cancer: Clin Cancer Res, 2000; 6; 2702-6, pmid: 10914713
30. Shariat SF, Andrews B, Kattan MW, Plasma levels of interleukin-6 and its soluble receptor are associated with prostate cancer progression and metastasis: Urology, 2001; 58; 1008-15, pmid: 11744478
31. Karban AS, Okazaki T, Panhuysen CI, Functional annotation of a novel NFKB1 promoter polymorphism that increases risk for ulcerative colitis: Hum Mol Genet, 2004; 13(1); 35-45, pmid: 14613970
32. Abdallah A, Sato H, Grutters JC, Inhibitor kappa B-alpha (IkappaB-alpha) promoter polymorphisms in UK and Dutch sarcoidosis: Genes Immun, 2003; 4(6); 450-54, pmid: 12944982
In Press
Clinical Research
Institutional and Regional Variations in Access to Clinical Trials and Next-Generation Sequencing in Turkis...Med Sci Monit In Press; DOI: 10.12659/MSM.951027
Clinical Research
Low-Intensity Blood Flow-Restricted Multi-Joint Exercise Improves Muscle Function in Patients With Patellof...Med Sci Monit In Press; DOI: 10.12659/MSM.950516
Review article
Musculoskeletal Ultrasound and MRI in the Evaluation of Chemotherapy-Induced Peripheral Neuropathy: A ReviewMed Sci Monit In Press; DOI: 10.12659/MSM.951283
Clinical Research
Sensory Processing, Dissociation, and Affective Symptoms in Misophonia: A Cross-Sectional Study of 35 AdultsMed Sci Monit In Press; DOI: 10.12659/MSM.950938
Most Viewed Current Articles
17 Jan 2024 : Review article 10,187,196
Vaccination Guidelines for Pregnant Women: Addressing COVID-19 and the Omicron VariantDOI :10.12659/MSM.942799
Med Sci Monit 2024; 30:e942799
13 Nov 2021 : Clinical Research 3,708,487
Acceptance of COVID-19 Vaccination and Its Associated Factors Among Cancer Patients Attending the Oncology ...DOI :10.12659/MSM.932788
Med Sci Monit 2021; 27:e932788
14 Dec 2022 : Clinical Research 2,341,643
Prevalence and Variability of Allergen-Specific Immunoglobulin E in Patients with Elevated Tryptase LevelsDOI :10.12659/MSM.937990
Med Sci Monit 2022; 28:e937990
16 May 2023 : Clinical Research 706,524
Electrophysiological Testing for an Auditory Processing Disorder and Reading Performance in 54 School Stude...DOI :10.12659/MSM.940387
Med Sci Monit 2023; 29:e940387






