25 August 2015: Molecular Biology
Downregulation of MiR-30a is Associated with Poor Prognosis in Lung Cancer
Ruixue Tang CEF , Lu Liang CEF , Dianzhong Luo AG , Zhenbo Feng AG , Qiuxia Huang BC , Rongquan He BC , Tingqing Gan BC , Lihua Yang BC , Gang Chen ABCDG
DOI: 10.12659/MSM.894372
Med Sci Monit 2015; 21:2514-2520
Abstract
BACKGROUND: Recent reports have suggested that miR-30a plays a tumor-suppressive role in various cancers. However, miR-30a has not been completely studied in non-small lung cancer (NSCLC). Thus, the aim of the present study was to clarify the association between the expression of miR-30a and the clinicopathological features in NSCLC patients.
MATERIAL AND METHODS: Total RNA of miR-30a was extracted from 125 pairs of NSCLC patients (male 75, female 50) and their matching normal tissues. The miR-30a level was detected by using quantitative real-time polymerase chain reaction (qRT-PCR). Simultaneously, the 2–ΔCq method was used to calculate the correlation between miR-30a expression and the clinicopathological parameters and prognosis of NSCLC patients.
RESULTS: MiR-30a expression was significantly down-regulated in NSCLC tissues (4.0696±2.4178) compared to their non-tumor lung tissues (7.4530±3.0561, P<0.001). Level of miR-30a was negatively correlated to tumor size (r=–0.197, P=0.028), lymphatic metastasis (r=–0.312, P<0.001), clinical TNM stage (r=–0.299, P=0.001), pathological grading (I/II vs. III, r=–0.224, P=0.001), and histological classification (r=–0.299, P=0.001). Survival time was 3.23±2.18 months in the low miR-30a expression group, remarkably shorter than that of the high expression group (20.72±11.63 months, P<0.001).
CONCLUSIONS: MiR-30a may be regarded as a tumor suppressor in NSCLC, and it could become a prognostic marker and potential therapeutic target for NSCLC.
Keywords: Aged, 80 and over, Biomarkers, Tumor - genetics, Carcinoma, Non-Small-Cell Lung - secondary, Lung Neoplasms - pathology, Lymphatic Metastasis - pathology, RNA, Neoplasm - metabolism, Real-Time Polymerase Chain Reaction, young adult
Background
Lung cancer, especially non-small cell lung cancer (NSCLC), accounts for the most cancer-associated deaths globally, with the annual death rate of about 1.4 million [1]. A better apprehension of the potential molecular mechanism of tumor progression is crucial for evolving novel therapeutics for NSCLC [2]. Thus, identification of better underlying molecular makers for NSCLC is essential for more accurate early diagnosis and more effective therapeutic strategies.
MicroRNAs (miRNAs) are small, non-coding RNAs consisting of 19–25 nucleotides. MiRNAs can modulate target genes expression negatively by binding to the 3′-untranslated region (3′-UTR) [3]. It is widely realized that miRNAs may act as tumor suppressors or oncogenes in all steps of tumorigenesis [4]. MiR-30a is situated on chromosome 6q.13 and is produced by an intronic transcriptional unit [5]. Two mature forms of miR-30a exist – miR-30a-3p and miR-30a-5p. MiR-30a is deregulated in several malignant tumors, such as breast cancer [6], hepatocellular cancer [7], colon cancer [8], nasopharyngeal carcinoma [9], prostatic cancer [10], endometrial cancer [11], and cutaneous squamous cell carcinoma [12]. Similarly, a few studies reported the down-regulation of miR-30a in lung cancer tissues or cultured cells [13–18]. Three of the studies investigated the molecular mechanism of miR-30 [19–21], including epithelial-mesenchymal transition (EMT). However, no clinically relevant statistical analysis has been performed in studies of lung cancer.
Hence, in the present study, we examined miR-30a expression in 125 cases of NSCLC tissues and found that miR-30a was significantly down-regulated in NSCLC, and then we explored the relationship between expression of miR-30a in NSCLC tissues and the clinicopathological parameters, as well as survival.
Material and Methods
TISSUE SAMPLES:
This study enrolled 125 formalin-fixed, paraffin-embedded (FFPE) NSCLC tissues and their paired non-tumor tissues (male=75, female=50), obtained from the First Affiliated Hospital of Guangxi Medical University (Nanning, Guangxi, China) after pneumonectomy performed between January 2012 and February 2014. The mean age was 61.10 years, range 23–90 years. None of the patients received any cancer-related treatment before the operation. Fifty-seven patients had complete follow-up information. Written informed consent was obtained from the participants. The diagnosis was confirmed by 2 independent pathologists. The clinicopathological information, collected from medical records, is listed in Table 1. EGFR data were obtained as previously reported [22–27].
QRT-PCR:
RNA extraction and normalization, and quantitative real-time polymerase chain reaction (qRT-PCR) were performed as described previously [22,26–28]. MiR-191 and miR-103 were selected as endogenous controls as previously reported [27,29]. The sequences of miRNAs were: miR-30a (TaqMan® MicroRNA Assays, Applied Biosystems Cat. No. 4427975-000416, Life Technologies Grand Island, NY 14072 USA): 000417, UGUAAACAUCCUCGACUGGAAG; miR-191 (Applied Biosystems Cat. No. 4427975-000490): CAACGGAAUCCCAAAAGCAGCU; miR-103 (Applied Biosystems Cat. No. 4427975-000439): AGCAGCAUUGUACAGGGCUAUGA. The 10 μl RT reactions were performed using TaqMan® MicroRNA Reverse Transcription Kit (4366596, Applied Biosystems, Life Technologies Grand Island, NY 14072 USA). The PCR reactions were performed on an Applied Biosystems PCR7900. All the experiments were performed in triplicate, including no-pattern controls. Then 2−Δcq method was used to calculate the relevant expression values of miR-30 in NSCLC and corresponding normal tissues.
STATISTICAL ANALYSIS:
SPSS 20.0 was used in all statistical analysis. Student’s
Results
MIR-30A WAS SIGNIFICANTLY DOWN-REGULATED IN NSCLC TISSUES:
MiR-30a was significantly down-regulated in NSCLC tissues (4.0696±2.4178) compared with their paired adjacent non-cancerous tissues (7.4530±3.0561, P<0.001, Figure 1A, Table 1). In addition, an ROC curve was drawn to show the diagnostic role of miR-30a. The area under the curve (AUC) of miR-30a was 0.818 (95% CI: 0.766–0.870, P<0.001, Figure 1B).
CORRELATION OF MIR-30A EXPRESSION AND CLINICAL PARAMETERS IN NSCLC:
Down-regulation of miR-30a was correlated with a series of clinicopathological parameters, including patient age, tumor size, lymph node status, clinical TNM stage, and tumor histological grade. The older patients (4.5765±2.6626) had higher levels of miR-30a than the younger ones (3.4649±1.9437, P=0.008). Compared with the group with smaller tumors (≤3 cm, 4.6417±2.7824), miR-30a in the group of large tumors was markedly decreased (>3 cm, 3.5415±1.8972, P=0.012). MiR-30a level in patients with lymph node metastasis (3.4000±2.0103) was down-regulated in comparison with those without lymphatic metastasis (4.8946±2.6320, P<0.001). In comparison to early stages (I & II, 4.9074±2.6750), the relevant level of miR-30a in advanced stages was markedly decreased (III and IV, 3.4324±1.9961, P=0.001) (Figure 2).
Spearman correlation analysis demonstrated significant negative correlations between the low expression of miR-30a and a series of parameters, such as tumor size (r=−0.197,
ROC ANALYSES OF CLINICAL DATA:
ROC curves were utilized to ascertain the predictive value of miR-30a expression in NSCLC patients for disease progression. The AUC of tumor size was 0.614 (95% CI: 0.514–0.713, P=0.029). The AUC of lymphatic metastasis was 0.681 (95% CI: 0.584–0.778, P=0.001). The ROC curve showed an AUC of 0.674 (95% CI: 0.578–0.771, P=0.001) to predict clinical TNM stage (Figure 3).
ROLE OF MIR-30A LEVEL IN NSCLC SURVIVAL:
Fifty-seven patients obtained complete follow-up, including 21 cases with down-regulated miR-30a level and 36 with up-regulated miR-30a. Compared to the survival in the high-level group (20.72±11.63 months), the low-level group had a significantly poorer prognosis (3.23±2.18 months, P<0.001, Figure 4).
TARGETS PREDICTION OF MIR-30A:
We then searched in on-line databases for the predictive potential target genes of miR-30a, including MIRBD, TARGETSCAN, PICTAR, MICRORNA.ORG, TARGETMINER, and RNA22-HAS. Two qualified target genes, CELSR3 and TNRC6A, were found in at least 4 databases.
Discussion
Lung cancer, especially NSCLC, is the most common cause of cancer death in the world, and its incidence is steadily increasing [1]. NSCLC always spreads to further sites through hematologic or lymphatic means like adrenal glands and most lung cancer patients with adrenal glands are incurable [35]. The poor prognosis of lung cancer is principally due to diagnosis made at advanced clinical stages. Thus, recognition of more early biomarkers is urgently required [30]. Although several studies have suggested miR-30a as a suppressor gene for inhibiting the development of lung cancer [13–18], no correlation between miR-30a and clinicopathological parameters has been shown.
Among the studies, 3 covered related molecular mechanisms, validated via
In the current study, we analyzed the level of miR-30a in 125 NSCLC patients and demonstrated that miR-30a was remarkably lower, in accordance with previous studies [19–21]. The present study included more tissue cases (N=125) compared with the study of Kumarswamy et al. (N=64) and Jiang et al. (N=22). Notably, our data show that miR-30a was repressed in NSCLC tissues with large tumor size compared to those with smaller ones (
On account of the unknown mechanism of miR-30a, we then attempted to predict the potential target genes of miR-30a. We detected 2 eligible genes after searching in 6 bioinformatics databases: MIRBD, TARGETSCAN, PICTAR, MICRORNA.ORG, TARGETMINER, and RNA22-HSA. TNRC6A,. The proteins, encoded by TNRC6A (also called GW1/GW182) assemble to miRNA targets via direct interactions with certain proteins and facilitate target silencing [32]. Then, CELSR3, a member of the cadherin superfamily with a role in cell contact-mediated communication, was detected to be over-regulated in pancreatic satellite cells (PSC) in pancreatic ductal adenocarcinoma (PDAC) [33]. It is unclear whether the activated PSC plays a significant role in promoting the occurrence and metastasis of pancreatic cancer [34]. However, no study has been aimed at the expression and mechanism of the 2 prediction targets in NSCLC. The genes mentioned above were just suggested based on theory. More experiments need to be carried out to explore the contribution of miR-30a in NSCLC through various targeting genes and molecular mechanisms.
Conclusions
Our study suggests the correlation between the expression of miR-30a and clinicopathological characteristics in NSCLC tissues. We have more NSCLC tissue samples (n=125) than any previous study in the literature. Together with previous reports, our study shows that miR-30a may act as a suppressive miRNA in tumorigenesis and progression of lung cancer In conclusion, our study suggests that miR-30a may be a new efficient biomarker for diagnosis and prognosis prediction for NSCLC patients, and it could also be a potential therapeutic target for NSCLC.
References
1. Siegel RL, Miller KD, Jemal A, Cancer statistics, 2015: Cancer J Clin, 2015; 65(1); 5-29
2. Soini Y, Tight junctions in lung cancer and lung metastasis: a review: Int J Clin Exp Pathol, 2012; 5(2); 126-36, pmid: 22400072
3. Di Leva G, Briskin D, Croce CM, MicroRNA in cancer: new hopes for antineoplastic chemotherapy: Ups J Med Sci, 2012; 117(2); 202-16, pmid: 22348396
4. Qian B, Nag SA, Su Y, miRNAs in cancer prevention and treatment and as molecular targets for natural product anticancer agents: Curr Cancer Drug Targets, 2013; 13(5); 519-41, pmid: 23597193
5. Rodriguez A, Griffiths-Jones S, Ashurst JL, Bradley A, Identification of mammalian microRNA host genes and transcription units: Genome Res, 2004; 14(10A); 1902-10, pmid: 15364901
6. Fu J, Xu X, Kang L, miR-30a suppresses breast cancer cell proliferation and migration by targeting Eya2: Biochem Biophys Res Commun, 2014; 445(2); 314-19, pmid: 24508260
7. Dai H, Kang B, Zuo D, Zuo GEffect of miR-30a-5p on the proliferation, apoptosis, invasion and migration of SMCC-7721 human hepatocellular carcinoma cells: Zhonghua Gan Zang Bing Za Zhi, 2014; 22(12); 915-20, pmid: 25654285 [in Chinese]
8. Zhang Q, Tang Q, Qin D, Role of microRNA 30a targeting insulin receptor substrate 2 in colorectal tumorigenesis: Mol Cell Biol, 2015; 35(6); 988-1000, pmid: 25582198
9. Wang HY, Li YY, Fu S: Exp Biol Med (Maywood), 2014; 239(7); 891-98, pmid: 24812123
10. Katz B, Reis ST, Viana NI, Comprehensive study of gene and microRNA expression related to epithelial-mesenchymal transition in prostate cancer: PLoS One, 2014; 9(11); e113700, pmid: 25409297
11. Tsukamoto O, Miura K, Mishima H, Identification of endometrioid endometrial carcinoma-associated microRNAs in tissue and plasma: Gynecol Oncol, 2014; 132(3); 715-21, pmid: 24491411
12. Sand M, Skrygan M, Georgas D, Microarray analysis of microRNA expression in cutaneous squamous cell carcinoma: J Dermatol Sci, 2012; 68(3); 119-26, pmid: 23026055
13. Hu Z, Chen X, Zhao Y, Serum microRNA signatures identified in a genome-wide serum microRNA expression profiling predict survival of non-small-cell lung cancer: J Clin Oncol, 2010; 28(10); 1721-26, pmid: 20194856
14. Markou A, Tsaroucha EG, Kaklamanis L, Prognostic value of mature microRNA-21 and microRNA-205 overexpression in non-small cell lung cancer by quantitative real-time RT-PCR: Clin Chem, 2008; 54(10); 1696-704, pmid: 18719201
15. Patnaik SK, Kannisto E, Knudsen S, Yendamuri S, Evaluation of microRNA expression profiles that may predict recurrence of localized stage I non-small cell lung cancer after surgical resection: Cancer Res, 2010; 70(1); 36-45, pmid: 20028859
16. Voortman J, Goto A, Mendiboure J, MicroRNA expression and clinical outcomes in patients treated with adjuvant chemotherapy after complete resection of non-small cell lung carcinoma: Cancer Res, 2010; 70(21); 8288-98, pmid: 20978195
17. Yanaihara N, Caplen N, Bowman E, Unique microRNA molecular profiles in lung cancer diagnosis and prognosis: Cancer Cell, 2006; 9(3); 189-98, pmid: 16530703
18. Yu SL, Chen HY, Chang GC, MicroRNA signature predicts survival and relapse in lung cancer: Cancer Cell, 2008; 13(1); 48-57, pmid: 18167339
19. Jiang BY, Zhang XC, Su J, BCL11A overexpression predicts survival and relapse in non-small cell lung cancer and is modulated by microRNA-30a and gene amplification: Mol Cancer, 2013; 12; 61, pmid: 23758992
20. Kumarswamy R, Mudduluru G, Ceppi P, MicroRNA-30a inhibits epithelial-to-mesenchymal transition by targeting Snai1 and is downregulated in non-small cell lung cancer: Int J Cancer, 2012; 130(9); 2044-53, pmid: 21633953
21. Liu K, Guo L, Guo Y, AEG-1 3′-untranslated region functions as a ceRNA in inducing epithelial-mesenchymal transition of human non-small cell lung cancer by regulating miR-30a activity: Eur J Cell Biol, 2015; 94(1); 22-31, pmid: 25484183
22. Chen G, Kronenberger P, Teugels E, De Greve J, Influence of RT-qPCR primer position on EGFR interference efficacy in lung cancer cells: Biol Proced Online, 2011; 13; 1, pmid: 21369532
23. Chen G, Kronenberger P, Teugels E, Targeting the epidermal growth factor receptor in non-small cell lung cancer cells: the effect of combining RNA interference with tyrosine kinase inhibitors or cetuximab: BMC Med, 2012; 10; 28, pmid: 22436374
24. Chen G, Kronenberger P, Teugels E, Effect of siRNAs targeting the EGFR T790M mutation in a non-small cell lung cancer cell line resistant to EGFR tyrosine kinase inhibitors and combination with various agents: Biochem Biophys Res Commun, 2013; 431(3); 623-29, pmid: 23266614
25. Chen G, Kronenberger P, Umelo IA, Quantification of epidermal growth factor receptor T790M mutant transcripts in lung cancer cells by real-time reverse transcriptase-quantitative polymerase chain reaction: Anal Biochem, 2010; 398(2); 266-68, pmid: 19961825
26. Chen G, Noor A, Kronenberger P, Synergistic effect of afatinib with su11274 in non-small cell lung cancer cells resistant to gefitinib or erlotinib: PLoS One, 2013; 8(3); e59708, pmid: 23527257
27. Chen G, Umelo IA, Lv S, miR-146a inhibits cell growth, cell migration and induces apoptosis in non-small cell lung cancer cells: PLoS One, 2013; 8(3); e60317, pmid: 23555954
28. Rong M, He R, Dang Y, Chen G, Expression and clinicopathological significance of miR-146a in hepatocellular carcinoma tissues: Ups J Med Sci, 2014; 119(1); 19-24, pmid: 24172202
29. Zhang X, Li P, Rong M, MicroRNA-141 is a biomarker for progression of squamous cell carcinoma and adenocarcinoma of the lung: clinical analysis of 125 patients: Tohoku J Exp Med, 2015; 235(3); 161-69, pmid: 25746592
30. Duffy MJ, Role of tumor markers in patients with solid cancers: A critical review: Eur J Intern Med, 2007; 18(3); 175-84, pmid: 17449388
31. Thiery JP, Acloque H, Huang RY, Nieto MA, Epithelial-mesenchymal transitions in development and disease: Cell, 2009; 139(5); 871-90, pmid: 19945376
32. Braun JE, Huntzinger E, Izaurralde E, The role of GW182 proteins in miRNA-mediated gene silencing: Adv Exp Med Biol, 2013; 768; 147-63, pmid: 23224969
33. Erkan M, Weis N, Pan Z, Organ-, inflammation- and cancer specific transcriptional fingerprints of pancreatic and hepatic stellate cells: Mol Cancer, 2010; 9; 88, pmid: 20416094
34. Ni JQ, Jiang XH, Tang WH, Relationship between pancreatic stellate cells and pancreatic cancer: Shijie Huaren Xiaohua Zazhi, 2008(33); 3782-86
35. Taira N, Kawabata T, Ichi T, Long-term survival after surgical treatment of metachronous bilateral adrenal metastases of non-small cell lung carcinoma: Am J Case Rep, 2014; 15; 444-46, pmid: 25317919
In Press
Clinical Research
Nasal Mucociliary Clearance and Its Relationship With Disease Severity in Patients With Multiple SclerosisMed Sci Monit In Press; DOI: 10.12659/MSM.952850
Clinical Research
Modified Thoracoabdominal Nerves Block Through the Perichondrial Approach vs Subcostal Transversus Abdomini...Med Sci Monit In Press; DOI: 10.12659/MSM.953976
Clinical Research
Establishment of a Novel Approach for Drug Abuse Monitoring and Its Application in Medical InstitutionsMed Sci Monit In Press; DOI: 10.12659/MSM.952054
Database Analysis
Epidemiology of Incidence and Mortality Due to Head and Neck Cancer in Poland in 2000 to 2022Med Sci Monit In Press; DOI: 10.12659/MSM.952477
Most Viewed Current Articles
17 Jan 2024 : Review article 14,176,622
Vaccination Guidelines for Pregnant Women: Addressing COVID-19 and the Omicron VariantDOI :10.12659/MSM.942799
Med Sci Monit 2024; 30:e942799
13 Nov 2021 : Clinical Research 3,763,552
Acceptance of COVID-19 Vaccination and Its Associated Factors Among Cancer Patients Attending the Oncology ...DOI :10.12659/MSM.932788
Med Sci Monit 2021; 27:e932788
14 Dec 2022 : Clinical Research 2,466,355
Prevalence and Variability of Allergen-Specific Immunoglobulin E in Patients with Elevated Tryptase LevelsDOI :10.12659/MSM.937990
Med Sci Monit 2022; 28:e937990
16 May 2023 : Clinical Research 708,950
Electrophysiological Testing for an Auditory Processing Disorder and Reading Performance in 54 School Stude...DOI :10.12659/MSM.940387
Med Sci Monit 2023; 29:e940387






