12 October 2015: Clinical Research
The Correlation Relationship between P14ARF Gene DNA Methylation and Primary Liver Cancer
Hui Zhang FG , Wanpin Nie DE , Feizhou Huang ABC
DOI: 10.12659/MSM.894395
Med Sci Monit 2015; 21:3077-3082
Abstract
BACKGROUND: Primary liver cancer is a common malignant tumor that causes serious damage to human health. DNA methylation is common in epigenetics. DNA methylation plays an important role in the process of primary liver cancer occurrence and development. The P14ARF gene is an important tumor suppressor gene. It was found that P14ARF methylation is associated with the degree of malignancy in multiple tumors. Therefore, this study aimed to investigate the relationship between P14ARF methylation level and primary liver cancer malignant degree.
MATERIAL AND METHODS: Carcinoma tissues and adjacent tissues were collected from 87 primary liver cancer patients. Pyrosequencing was applied to obtain P14ARF methylation. Real-time PCR was used to detect P14ARF mRNA level.
RESULTS: P14ARF methylation level in cancerous tissue was significantly higher than in the adjacent tissue (t=76.54, P<0.001). P14ARF methylation showed no significant difference in patients with different age, sex, smoking status, or drinking status. It did not present an obvious difference in tumors with different size. Its methylation level increased following the improvement of TNM stage (P<0.05). Compared with the adjacent tissue, P14ARF mRNA in carcinoma tissue decreased by 31% (t=28.91, P<0.001). P14ARF methylation showed a significant negative correlation with mRNA expression in cancerous tissue (r=–0.43, P<0.01).
CONCLUSIONS: P14ARF mRNA level is regulated by DNA methylation in primary liver cancer. P14ARF gene DNA methylation may be associated with the occurrence of primary liver cancer occurrence and TNM staging.
Keywords: Carcinoma - genetics, Cyclin-Dependent Kinase Inhibitor p16 - genetics, DNA Methylation, Epigenesis, Genetic, RNA, Messenger - metabolism, Real-Time Polymerase Chain Reaction, Sarcoglycanopathies - pathology, Sequence Analysis, DNA, Tumor Suppressor Protein p14ARF - genetics
Background
Primary liver cancer is a common malignant tumor with great impacts on human health and economics and its incidence is continuously rising [1]. Following the development of serum AFP clinical application and imaging techniques, more liver cancers are found in the early stage. Early liver cancer treatment also has experienced great progress, but the 5-year survival rate has not significantly improved. Currently, researchers found that, in addition to genetic factors and environmental factors, epigenetic changes also play an important role in tumor development [2].
DNA methylation is a common epigenetic modification that is closely related to tumor occurrence and development, and even potential biomarkers for tumor [3]. Abnormal DNA methylation in tumors is mainly presented as specific gene hypermethylation and genome-wide hypomethylation. It can increase chromosome instability or cause tumor suppressor gene inactivation, resulting in tumor occurrence. Studies have shown that DNA methylation change is related to primary liver cancer occurrence. Multiple genes in liver tissue, such as SASH1 [4], GPX3 [5], RASSF1A [6], GSTP1 [7], and P16 genes [8], are found as DNA methylation levels increase, while genome-wide alternative gene LINE-1 methylation level decrease [9,10]. The P14ARF gene is an important tumor suppressor gene that has a negative regulatory role in the cell cycle. Kawamoto [11] found that P14ARF gene DNA methylation level is associated with the pathological staging of bladder cancer. The present study investigated the relationship between P14ARF methylation level and primary liver cancer malignant degree by pyrosequencing to provide a basis for liver cancer early diagnosis, prognosis, and treatment.
Material and Methods
MAIN REAGENTS AND INSTRUMENTS:
EpiTect Fast DNA Bisulfite Kit (QIAGEN), PyroMark PCR Kit (QIAGEN), PyroMarkCpG Assay 96 well (QIAGEN), PyroMark Q96 ID sequencer (QIAGEN), Trizol (Invitrogen), Real-time PCR kit (Takara), gel-imaging system, ViiA7 real-time PCR amplifier (ABI).
OBJECTS AND SAMPLES:
We enrolled 87 liver cancer patients that needed surgery from Third Xiangya Hospital between Jan 2012 and Oct 2014. All of the selected patients received no radiotherapy or chemotherapy preoperatively. Carcinoma tissues and adjacent tissues that were at least 2 cm away from the cancer edge were collected. Liver cancer staging was according to the international standard of TNM stage. Smoking status was defined as at least 1 cigarette a day for more than 1 year. Drinking status was defined as at least 1 drink per month.
The experimental protocol was pre-approved by the ethics committee of our hospital and written consents were obtained from all patients and healthy volunteers.
DNA EXTRACTION AND BISULFITE MODIFICATION:
Salt fractionation was adopted to extract the whole genome DNA. Sample absorbance of A260/A280 between 1.8 and 2.0 could be used in the subsequent experiment. 2 μg DNA was modified and purified using EpiTect Bisulfite Kit (QIAGEN), according to the manual. Genomic DNA treated by
:
As previously reported [12], PCR amplification and sequencing primers were synthesized by Shanghai Generay biological engineering co., LTD. PCR primers were as follows: F: TTTATTTGGTTTTTTAGGAAG, R: Biotin-CAAATTCTTAATAACCCTCC, sequencing primers: GTTGGTTTTTTAGTAGTATTAGTA. P14ARF gene target segment was amplified according to the PyroMark PCR Kit instructions. The cycling conditions consisted of an initial, single cycle of 15 min at 95°C, followed by 45 cycles of 30 s at 94°C, 30 s at 56°C, and 30 s at 72°C, and single cycle of 10 min at 72°C. Five μl of amplification product was identified by agarose gel electrophoresis. One chain of the PCR product with biotin was mixed with magnetic beads carrying streptavidin. After separated by vacuum preprocessor, single-stranded DNA was mixed with P14ARF sequencing primer and sequenced in the PyroMark Q96 ID System (Qiagen) sequencer. Three independent experiments were performed.
:
Total RNA was extracted by TRIzol. The cDNA was synthesized using reverse transcriptase (TaKaRa), oligo (dT) primers with 1 μg RNA. P14ARF primer was according to Zhang’s report [13]. The primers used are listed in Table 1. Each real-time RT-PCR reaction (in 20 μL) contained 2×SYBR Green Mixture (TIANGEN), 0.5 μL primers, and 0.5 μL template cDNA. The cycling conditions consisted of an initial, single cycle of 10 min at 95°C, followed by 40 cycles of 15 s at 95°C and 60 s at 60°C. PCR amplifications were performed in 3 duplicates for each sample. Gene expression levels were quantified relative to the expression of β-actin using an optimized comparative Ct (ΔΔCt) value method. The differences in gene expression levels between groups were compared using the t test. P values <0.05 were considered statistically significant.
STATISTICAL ANALYSIS:
All statistical analyses were performed using SPSS13.0 software (SPSS Inc., USA). Differences between multiple groups were analyzed by t test or one-way ANOVA. Linear regression analysis was used for the trend analysis. Pearson correlation analysis was applied when the double variable complied with normal distribution, inspection level α=0.05.
Results
:
P14ARF gene DNA methylation level in carcinoma tissue was 43.56±3.00%, and it was 20.50±0.67% in adjacent tissue; the paired t test showed that P14 ARF gene DNA methylation level was significantly higher than in the adjacent tissue (t=76.54, P<0.001). When comparing P14ARF gene DNA methylation level in different TNM stages, we found that P14ARF gene DNA methylation level was obviously higher in carcinoma tissue in stage I, II, and III (P<0.001) (Table 2).
:
As shown in Table 3, P14ARF methylation showed no significant difference in patients with different age, sex, smoking status, or drinking status. It did not present obvious difference in tumors with different sizes. It showed a significant difference among patients in stage I, II, and III by one-way ANOVA analysis (F=76.30, P<0.001). To avoid the interference of possible confounding factors, multiple linear regression results showed that P14ARF methylation level increased following the improvement of TNM stage (P<0.05).
:
Real-time PCR was used to detect P14ARF mRNA expression level (Figure 1). Compared with the adjacent tissue, P14ARF mRNA expression decreased by about 31% in carcinoma tissue (t=28.91, P<0.001). One-way ANOVA results revealed that P14ARF mRNA level was different in patients with different TNM stage (F=24.15, P<0.001). Linear regression analysis suggested that its level reduced gradually following TNM staging increase (P<0.05).
:
Pearson correlation analysis indicated that P14ARF methylation showed a significant negative correlation with mRNA expression in cancerous tissue (r=−0.43, P<0.01). Following the P14ARF gene methylation level increase, P14ARF mRNA expression declined gradually, suggesting that P14ARF mRNA expression changes in primary liver cancer might be regulated by DNA methylation.
Discussion
Epigenetics is a concept corresponding to genetics, which mainly includes DNA methylation, histone covalent modification, and RNA editing. Abnormal DNA methylation is closely related to tumor occurrence, such as lung cancer [14], gastric cancer [15], and colorectal cancer [16]. It is even closely associated with tumor prognosis [17]. Thus, more and more researchers committed to DNA methylation for tumor early diagnosis and treatment. There were numerous DNA methylation detection methods, mainly including methylation-specific PCR, methylation fluorescence PCR, and bisulfite sequencing PCR. However, the abovementioned methods can only detect qualitative, semi-quantitative, or relative quantitative levels of DNA methylation. Pyrosequencing is a technique based on DNA sequence analysis [18] that could be used for accurate DNA methylation quantification. Thus, it is the criterion standard for DNA methylation analysis.
P14ARF gene is a tumor suppressor gene located on short arm 21th segment of chromosome 9. It codes a 14 kD protein that can bind with MDM2 protein to speed its degradation, further stabilize p53 protein, and play a role as cell cycle check point [19]. Therefore, this study aimed to investigate the relationship between P14ARF methylation level and primary liver cancer TNM staging by pyrosequencing. The results showed that P14ARF methylation level in the cancer tissue was significantly higher than that of adjacent tissue, while P14ARF mRNA level was reduced in cancerous tissue compared with the adjacent tissue and exhibited a negative correlation with DNA methylation. This indicates that P14ARF gene DNA methylation is associated with primary liver cancer occurrence. P14ARF gene mRNA expression in carcinoma tissues could be affected by DNA methylation, which is consistent with previous results. Zhang et al. used methylation-specific PCR to detect P14ARF gene DNA methylation level in liver cancer tissue and found that P14ARF DNA methylation level in liver cancer tissue (53.3%) was higher than in normal tissue (33.3%) [13]. DNA methylation level increase may cause P14ARF gene expression silencing. Many other studies also suggested that P14ARF methylation was higher in liver cancer tissue than in normal tissue [20–23]. The meta-analysis results reported by Li indicated that primary liver cancer risk was associated with P14ARF gene DNA methylation level [24]. All of these research results revealed that P14ARF gene DNA methylation may be associated with primary liver cancer occurrence.
Our study found that P14ARF gene DNA methylation level in carcinoma tissue was gradually up-regulated following the improvement of TNM staging, suggesting that P14ARF gene DNA methylation might be associated with TNM stage, malignant degree, and prognosis. However, Anzola reported that P14ARF gene DNA methylation showed no association with TNM staging [23]. They analyzed the correlation between cancer tissue differentiation degree and DNA methylation, and used methylation-specific PCR method. These may cause the different results of the 2 studies.
Conclusions
To the best of our knowledge, this study is the first to use pyrosequencing to analyze the correlation between P14ARF gene DNA methylation and primary liver cancer. Compared with the previous study, we applied a more accurate method for analysis. However, since only 87 cases were included, further studies with larger sample sizes are needed to determine whether the P14ARF gene can be used as a biomarker for primary liver cancer early diagnosis and prognosis evaluation.
References
1. Acharya SK, Epidemiology of hepatocellular carcinoma in India: J Clin Exp Hepatol, 2014; 4; S27-33, pmid: 25755607
2. Falahi F, Sgro A, Blancafort P, Epigenome engineering in cancer: fairytale or a realistic path to the clinic?: Front Oncol, 2015; 5; 22, pmid: 25705610
3. Ng JM, Yu J, Promoter hypermethylation of tumour suppressor genes as potential biomarkers in colorectal cancer: Int J Mol Sci, 2015; 16; 2472-96, pmid: 25622259
4. Peng L, Wei H, Liren L, Promoter methylation assay of SASH1 gene in hepatocellular carcinoma: J BUON, 2014; 19; 1041-47, pmid: 25536614
5. Cao S, Yan B, Lu Y, Methylation of promoter and expression silencing of GPX3 gene in hepatocellular carcinoma tissue: Clin Res Hepatol Gastroenterol, 2015; 39(2); 198-204, pmid: 25445749
6. Jain S, Xie L, Boldbaatar B, Differential methylation of the promoter and first exon of the RASSF1A gene in hepatocarcinogenesis: Hepatol Res, 2014 [Epub ahead of print]
7. Rongrui L, Na H, Zongfang L, Epigenetic mechanism involved in the HBV/HCV-related hepatocellular carcinoma tumorigenesis: Curr Pharm Des, 2014; 20; 1715-25, pmid: 23888939
8. Zang JJ, Xie F, Xu JF, P16 gene hypermethylation and hepatocellular carcinoma: a systematic review and meta-analysis: World J Gastroenterol, 2011; 17; 3043-48, pmid: 21799651
9. Harada K, Baba Y, Ishimoto T, LINE-1 Methylation Level and Patient Prognosis in a Database of 208 Hepatocellular Carcinomas: Ann Surg Oncol, 2015; 22; 1280-87, pmid: 25319577
10. Zhu C, Utsunomiya T, Ikemoto T, Hypomethylation of long interspersed nuclear element-1 (LINE-1) is associated with poor prognosis via activation of c-MET in hepatocellular carcinoma: Ann Surg Oncol, 2014; 21(Suppl 4); S729-35, pmid: 24992910
11. Kawamoto K, Enokida H, Gotanda T, p16INK4a and p14ARF methylation as a potential biomarker for human bladder cancer: Biochem Biophys Res Commun, 2006; 339; 790-96, pmid: 16316628
12. Lof-Ohlin ZM, Nilsson TK, Pyrosequencing assays to study promoter CpG site methylation of the O6-MGMT, hMLH1, p14ARF, p16INK4a, RASSF1A, and APC1A genes: Oncol Rep, 2009; 21; 721-29, pmid: 19212632
13. Zhang C, Guo X, Zhang L, Methylation-related silencing of p14ARF gene correlates with telomerase activity and mRNA expression of human telomerase reverse transcriptase in hepatocellular carcinoma: J Surg Oncol, 2008; 98; 462-68, pmid: 18683194
14. Hubers AJ, Heideman DA, Burgers SA, DNA hypermethylation analysis in sputum for the diagnosis of lung cancer: training validation set approach: Br J Cancer, 2015; 112; 1105-13, pmid: 25719833
15. Deng J, Liang H, Ying G, Poor survival is associated with the methylated degree of Zinc-finger protein 545 (ZNF545) DNA promoter in gastric cancer: Oncotarget, 2015; 6; 4482-95, pmid: 25714013
16. Farkas SA, Befekadu R, Hahn-Stromberg V, Nilsson TK, DNA methylation and expression of the folate transporter genes in colorectal cancer: Tumour Biol, 2015 [Epub ahead of print]
17. Ko E, Kim Y, Kim SJ, Promoter hypermethylation of the p16 gene is associated with poor prognosis in recurrent early-stage hepatocellular carcinoma: Cancer Epidemiol Biomarkers Prev, 2008; 17; 2260-67, pmid: 18723830
18. Harrington CT, Lin EI, Olson MT, Eshleman JR, Fundamentals of pyrosequencing: Arch Pathol Lab Med, 2013; 137; 1296-303, pmid: 23991743
19. Zhang Y, Xiong Y, Yarbrough WG, ARF promotes MDM2 degradation and stabilizes p53: ARF-INK4a locus deletion impairs both the Rb and p53 tumor suppression pathways: Cell, 1998; 92; 725-34, pmid: 9529249
20. Ito T, Nishida N, Fukuda Y, Alteration of the p14(ARF) gene and p53 status in human hepatocellular carcinomas: J Gastroenterol, 2004; 39; 355-61, pmid: 15168247
21. Zhang JC, Gao B, Yu ZT, Promoter hypermethylation of p14 (ARF), RB, and INK4 gene family in hepatocellular carcinoma with hepatitis B virus infection: Tumour Biol, 2014; 35; 2795-802, pmid: 24254306
22. Yang B, Guo M, Herman JG, Clark DP, Aberrant promoter methylation profiles of tumor suppressor genes in hepatocellular carcinoma: Am J Pathol, 2003; 163; 1101-7, pmid: 12937151
23. Anzola M, Cuevas N, Lopez-Martinez M, P14ARF gene alterations in human hepatocellular carcinoma: Eur J Gastroenterol Hepatol, 2004; 16; 19-26, pmid: 15095848
24. Li CC, Yu Z, Cui LH, Role of P14 and MGMT gene methylation in hepatocellular carcinomas: a meta-analysis: Asian Pac J Cancer Prev, 2014; 15; 6591-96, pmid: 25169493
In Press
Clinical Research
Combined Fibrinogen and Urinary α1-Microglobulin as Predictors of Respiratory Tract Infection in Children w...Med Sci Monit In Press; DOI: 10.12659/MSM.951066
Database Analysis
Evaluation of Salivary Total Oxidant Status (TOS) and Total Antioxidant Status (TAS) in Orthodontic Patient...Med Sci Monit In Press; DOI: 10.12659/MSM.952052
Clinical Research
Presence and Impact of Fatigue in Patients With Multiple SclerosisMed Sci Monit In Press; DOI: 10.12659/MSM.953344
Clinical Research
Levofloxacin-Induced Cutaneous Adverse Reactions: Characteristics and Rational Use StrategiesMed Sci Monit In Press; DOI: 10.12659/MSM.951518
Most Viewed Current Articles
17 Jan 2024 : Review article 14,175,746
Vaccination Guidelines for Pregnant Women: Addressing COVID-19 and the Omicron VariantDOI :10.12659/MSM.942799
Med Sci Monit 2024; 30:e942799
13 Nov 2021 : Clinical Research 3,757,029
Acceptance of COVID-19 Vaccination and Its Associated Factors Among Cancer Patients Attending the Oncology ...DOI :10.12659/MSM.932788
Med Sci Monit 2021; 27:e932788
14 Dec 2022 : Clinical Research 2,466,013
Prevalence and Variability of Allergen-Specific Immunoglobulin E in Patients with Elevated Tryptase LevelsDOI :10.12659/MSM.937990
Med Sci Monit 2022; 28:e937990
16 May 2023 : Clinical Research 708,680
Electrophysiological Testing for an Auditory Processing Disorder and Reading Performance in 54 School Stude...DOI :10.12659/MSM.940387
Med Sci Monit 2023; 29:e940387






