01 August 2011: Basic Research
Administration of obestatin accelerates the healing of chronic gastric ulcers in rats
Artur Dembinski ABCDEFG , Zygmunt Warzecha ABCDEF , Piotr Ceranowicz BCDE , Jakub Cieszkowski BCF , Marcin Dembinski BCEF , Agata Ptak-Belowska BC , Atsukasu Kuwahara AEG , Ikuo Kato AEG
DOI: 10.12659/MSM.881897
Med Sci Monit 2011; 17(8): BR196-200
Background
Obestatin is a 23-amino acid peptide derived from proghrelin, a common prohormone for ghrelin and obestatin [1]. Obestatin, like ghrelin, was originally extracted from rat stomach, and the stomach seems to be a major source of circulating obestatin [1,2]. Secretion of obestatin is pulsatile, and plasma obestatin level exhibits an ultradian pulsatility with a frequency slightly lower than octanoylated ghrelin and growth hormone [3].
Synthesis and release of ghrelin in the stomach is related to gastric condition. In patients with
Previous studies have shown that administration of ghrelin protects various organs such as the heart [6], kidney [7] and brain [8] against ischemic injury and attenuates sepsis-induced lung injury and mortality [9]. Moreover, ghrelin affects the bone metabolism, stimulating osteogenesis and improving the repair of bone defects [10]. In the gut, pretreatment with ghrelin reduces gastric mucosal damage induced by noxious agents [11–13] and inhibits the development of acute experimental pancreatitis [14,15]. Moreover, apart from its protective effect, ghrelin accelerates the healing of gastric ulcers [16] and exhibits a therapeutic effect in the course of acute pancreatitis [17] and colonic inflammation [18].
Recent studies have shown to that also obestatin exhibits some protective effects. Obestatin promotes survival of pancreatic islets [19], and pretreatment with obestatin inhibits the development of cerulein-induced acute pancreatitis [20].
Tumor necrosis factor-α (TNF-α) and interleukin-1β (IL-1β) are cytokines involved in systemic inflammation and are members of a group of cytokines that stimulate acute phase reaction. TNF-α and IL-1β are produced mainly by macrophages, but a broad variety of other cell types is also involved in their production [21].
The role of obestatin in the healing of gastric ulcers is unknown. Therefore, the aim of our present investigation was to examine whether obestatin administration exhibits any effect on the healing of chronic gastric ulcers and whether obestatin affects mucosal expression of pro-inflammatory cytokines.
Material and Methods
ANIMALS AND TREATMENT:
Studies were performed on 80 male Wistar rats weighing 180–200 g and divided randomly into 8 groups. Experiments were conducted following the experimental protocol approved by the Local Commission of Ethics for the Care and Use of Laboratory Animals. Animals were housed in cages with wire mesh bottoms, in normal room temperature (22±1°C) and a 12-h light-dark cycle.
After fasting for 16 h, rats were anesthetized with pentobarbital (30 mg/kg i.p., Vetbutal, Biowet, Puławy, Poland) and chronic gastric ulcers were induced using our modification [22] of a method originally described by Okabe et al [23]. Briefly, the abdomen was opened and the stomach was exposed. A plastic tube of 4.2 mm inner diameter was applied tightly to the serosal surface of the anterior wall of the distal portion of the stomach, proximal to the pylorus. About 70 μl of 100% acetic acid was applied through this tube for 20 s. After removal of the acetic acid, the abdomen was closed by sutures. This method was found to result in the formation of chronic ulceration of mucosa and submucosa within the area of acetic acid application. All rats were fasted with unlimited access to water at day 0 and then had free access to food and water.
After induction of ulcers or sham operation, rats were treated with saline (0.9% solution of NaCl) or obestatin given intraperitoneally twice a day for 6 days (the first injection at the day of ulcer induction, the last injection 1 h before the end of experiment). Obestatin was administered at the dose of 4, 8 or 16 nmol/kg/dose. Experiments were repeated to obtain 10 observations in each experimental group.
Rat obestatin was synthesized at the Yanaihara Institute by a solid phase methodology with Fmoc strategy using an automated peptide synthesizer (Applied Biosystem 9030 Pioneer, Foster, CA, USA). Analytical HPLC and MALDI-TOF MS confirmed the homology of the product.
DETERMINATION OF GASTRIC BLOOD FLOW AND MUCOSAL LESIONS:
Six days after induction of chronic gastric ulcers, rats were anesthetized again with pentobarbital and the abdomen was opened by a midline incision. The stomach was exposed and the gastric mucosal blood flow was measured using laser Doppler flowmeter (PeriFlux 4001 Master monitor, Perimed AB, Järfälla, Sweden). Blood flow was measured in 5 areas of gastric mucosa and mean value of 5 recordings was presented as percent of mucosal blood flow recorded in saline-treated control rats without induction of ulcers. After measurement of mucosal blood flow the area of ulcerated mucosa was measured using a computerized planimeter (Morphomat, Carl Zeiss, Berlin, Germany) as described previously [24]. The measurement was made by a person blinded to the origin of coded specimens.
BIOCHEMICAL ANALYSIS:
Expression of mRNA for interleukin-1β and TNF-α was determined using reverse transcriptase-polymerase chain reaction (RT-PCR) as described previously [25]. Samples of gastric mucosa were snap frozen in liquid nitrogen and stored at −80°C until RNA extraction. The interleukin-1β primer sequences were: sense, GCTACCTATGTCTTGCCCGT, and antisense, GACCATTGCTGTTTCCTAGG; the expected length of the product was 543 bp. The TNF-α primer sequences were: sense, TACTGAACTTCGGGGTGATTGGTCC, and antisense, CAGCCTTGTCCCTTGAAGAGAACC; the expected length of the product was 295 bp. The β-actin primer sequences were: sense, TTGTAACCAACTGGGACGATATGG, and antisense, GATCTTGATCTTCATGGTGCTAGG; the expected length of the product was 764 bp. Polymerase chain reaction products were detected by electrophoresis on a 1.5% agarose gel containing ethidium bromide. Location of predicted products was confirmed by using 100-bp ladder (Takara, Shiga, Japan) as a standard size marker. The gel was then photographed under UV trans-illumination. The intensity of PCR products was measured using a video image analysis system (Kodak Digital Science). The signal for investigated mRNA was standardized against that of the β-actin mRNA from each sample and the results were expressed as analyzed mRNA/b-actin mRNA ratio as described earlier [26].
DNA synthesis in gastric mucosa was determined by measurement of [3H]thymidine incorporation ([6-3H]-thymidine, 20–30 Ci/mmol, Institute for Research, Production and Application of Radioisotopes, Prague, Czech Republic) into mucosal DNA as described previously [27]. The incorporation of labeled thymidine into DNA was determined by counting 0.5 ml DNA-containing supernatant in a liquid scintillation system. DNA synthesis was expressed as disintegrations of tritium per minute per μg DNA (dpm/μg DNA).
STATISTICAL ANALYSIS:
Results were expressed as mean ±SEM. Statistical analysis was carried out by one-way analysis of variance (ANOVA) followed by the Tukey multiple comparison test using GraphPadPrism (GraphPad Software, San Diego, CA, USA). Differences were considered to be statistically significant when
Results
Figure 1 shows the influence of obestatin administration on the healing of chronic gastric ulcers. In saline- or obestatin-treated rats without induction of ulcer, no ulcers were observed. In saline-treated rats, 6 days after induction of ulcers, ulcer area was 10.8±0.5 mm2. Treatment with obestatin given at the dose of 4, 8 and 16 nmol/kg/dose reduced ulcer area by 12%, 29% and 27%, respectively. Effect of obestatin given at the doses of 8 and 16 nmol/kg/dose was statistically significant.
In rats without induction of ulcers, administration of obestatin failed to affect gastric mucosal blood flow (Figure 2). Induction of ulcers significantly increased gastric mucosal blood flow by 23% and this effect was additionally enhanced by treatment with obestatin. Obestatin given at the dose of 8 and 16 nmol/kg/dose exhibited similar and statistically significant effect on gastric mucosal blood flow in rats with ulcers; whereas effect of obestatin given at the dose of 4 nmol/kg was statistically insignificant.
In control saline-treated animals, gastric mucosal DNA synthesis reached a value of 75.2±2.8 dpm/μg DNA (Figure 3). Administration of obestatin failed to affect DNA synthesis in gastric mucosa in rats without induction of ulcers. In saline-treated rats with ulcers, gastric mucosal DNA synthesis was reduced by 42%. Treatment with obestatin partly reversed the ulcer-evoked reduction in DNA synthesis in gastric mucosa. This effect was statistically significant after obestatin was administered at the dose of 8 or 16 nmol/kg/dose.
In rats with intact gastric mucosa, administration of obestatin at the dose of 8 nmol/kg/dose was without effect on mucosal expression of mRNA for pro-inflammatory IL-1β in the stomach (Figure 4). Induction of gastric ulcer significantly increased mucosal expression of mRNA for IL-1β by 304%. Administration of obestatin at the dose of 8 nmol/kg/dose partly, but significantly, reversed the ulcer-evoked increase in mucosal expression of mRNA for interleukin-1β.
Administration of obestatin at the dose of 8 nmol/kg/dose was without effect on the ratio of mRNA for TNF-α to mRNA for β-actin in gastric mucosa in rats without induction of ulcers (Figure 5). Induction of ulcers increased expression of mRNA for TNF-α by 360%. Treatment with obestatin at the dose 8 nmol/kg/dose reduced the ulcer-evoked increase in expression of TNF-α mRNA by 61%, but this value was still higher than that observed in control rats with intact mucosa.
Discussion
Our present study has shown for the first time that obestatin exhibits therapeutic effect in the course of chronic gastric ulcers. This effect was related to a decrease in local inflammatory process, improvement of mucosal blood flow and enhancement of mucosal cell proliferation, leading to acceleration of gastric ulcer healing.
Direct mechanism of obestatin’s therapeutic effect is not clear because the cellular target of this peptide is uncertain. Initially, Zhang et al reported that obestatin binds and activates the orphan G protein-coupled receptor GPR39 [1]. On the other hand, numerous researchers have obtained opposite results. Chartrel et al. [28] found no specific binding of I125-obestatin to GRP39 receptor, and they observed no effects of obestatin on GPR39-transfected cells in various functional assays, using the same experimental conditions as Zhang et al. [1], therefore they concluded that obestatin is not the cognate ligand for GPR39 receptor. Similar negative results were also observed by Lauwers et al. [29] and Holst [30]. Facing the problem of inconsistent result, Zhang et al. have performed a new, precise study [31], investigating target cells for obestatin based on induction of an early-response gene c-
Circulation and perfusion of organs is a basic physiological process necessary to sustain oxygenation and nutrition at a cellular level. Microvascular impairment of the abdominal organs has been implicated in the pathogenesis of a variety of disorders, including peptic ulcer disease and inflammatory bowel disease [32]. Blood flow plays an important role in protection of normal gastric mucosa and in the healing of damaged mucosa [33]. Gastric hypoxia resulting in accumulation of H+ within gastric mucosa leads to mucosal acidification. Low mucosal blood flow predisposes to injury, whereas high blood flow protects against injurious agents. [33]. Development of peptic ulcer is associated with damage to blood vessels and reduction in mucosal blood flow. During ulcer healing mucosal blood flow returns to normal level [33]. These data are in agreement with results of our present study and indicates the role of blood flow in the therapeutic effect of obestatin in the course of chronic gastric ulcer. Treatment with obestatin has increased mucosal blood flow in the stomach; this effect has been associated with reduction in gastric ulcer area. This obestatin-evoked influence on gastric blood flow seems to be an indirect effect because administration of obestatin has failed to affect gastric blood flow in animals with intact gastric mucosa.
Healing of gastric ulcers needs cell proliferation; this process is required for complete regeneration of damaged mucosa [34]. DNA synthesis precedes cell division and the rate of mucosal DNA synthesis is an index of mucosal cell proliferation. In our present study, obestatin failed to affect DNA synthesis in gastric mucosa in rats without ulcers, but significantly reversed the ulcer-evoked reduction in this parameter. These findings indicate that the obestatin-evoked acceleration of gastric ulcer healing involves promotion of mucosal cell proliferation, but it seems to be the secondary, indirect effect.
Our present study has shown that induction of ulcers increases mucosal expression of mRNA for IL-1β and TNF-α. Both of these factors are cytokines involved in local and systemic inflammation, and act synergistically. They are inducers of endothelial adhesion molecules, which are essential for the adhesion of leukocytes to the endothelial surface prior to their migration into the tissues. IL-1β and TNF-α play a crucial role in the stimulation of acute phase reaction [21,35]. These data, together with our observation that treatment with obestatin reverses the ulcer-induced increase in mucosal expression of mRNA for IL-1β and TNF-α, indicate that the therapeutic effect of obestatin involves inhibition of mucosal inflammation.
Conclusions
Our study has demonstrated that treatment with obestatin accelerates healing of chronic gastric ulcers and this effect is related to improvement of mucosal blood flow, increase in mucosal cell proliferation and reduction in local expression of pro-inflammatory cytokines.
References
1. Zhang JV, Ren PG, Avsian-Kretchmer O, Obestatin, a peptide encoded by the ghrelin gene, opposes ghrelin’s effects on food intake: Science, 2005; 310; 996-99, pmid: 16284174
2. Furnes MW, Stenstrom B, Tommeras K, Feeding behavior in rats subjected to gastrectomy or gastric bypass surgery: Eur Surg Res, 2008; 40; 279-88, pmid: 18253047
3. Zizzari P, Longchamps R, Epelbaum J, Obestatin partially affects ghrelin stimulation of food intake and growth hormone secretion in rodents: Endocrinology, 2007; 148; 1648-53, pmid: 17204551
4. Zub-Pokrowiecka A, Rembiasz K, Konturek PC: Med Sci Monit, 2010; 16(10); CR493-500, pmid: 20885354
5. Gao XY, Kuang HY, Liu XM, Circulating ghrelin/obestatin ratio in subjects with Helicobacter pylori infection: Nutrition, 2009; 25; 506-11, pmid: 19131215
6. Frascarelli S, Ghelerdoni S, Ronca-Testoni S, Zucchi R, Effect of ghrelin and synthetic growth hormone secretagogues in normal and ischemic rat heart: Basic Res Cardiol, 2003; 98; 401-5, pmid: 14556085
7. Takeda R, Nishimatsu H, Suzuki E, Ghrelin improves renal function in mice with ischemic acute renal failure: J Am Soc Nephrol, 2006; 17; 113-21, pmid: 16306169
8. Liu Y, Wang PS, Xie D, Ghrelin reduces injury of hippocampal neurons in a rat model of cerebral ischemia/reperfusion: Chin J Physiol, 2006; 49; 244-50, pmid: 17294832
9. Wu R, Dong W, Zhou M, Ghrelin attenuates sepsis-induced acute lung injury and mortality in rats: Am J Respir Crit Care Med, 2007; 176; 805-13, pmid: 17626913
10. Nikolopoulos D, Theocharis S, Kouraklis G, Ghrelin, another factor affecting bone metabolism: Med Sci Monit, 2010; 16(7); RA147-62, pmid: 20581789
11. Sibilia V, Rindi G, Pagani F, Ghrelin protects against ethanol-induced gastric ulcers in rats: studies on the mechanisms of action: Endocrinology, 2003; 144; 353-59, pmid: 12488364
12. Brzozowski T, Konturek PC, Konturek SJ, Exogenous and endogenous ghrelin in gastroprotection against stress-induced gastric damage: Regul Pept, 2004; 120; 39-51, pmid: 15177919
13. Iseri SO, Sener G, Yuksel M, Ghrelin against alendronate-induced gastric damage in rats: J Endocrinol, 2005; 187; 399-406, pmid: 16423819
14. Dembiński A, Warzecha Z, Ceranowicz P, Ghrelin attenuates the development of acute pancreatitis in rats: J Physiol Pharmacol, 2003; 54; 561-73, pmid: 14726611
15. Dembiński A, Warzecha Z, Ceranowicz P, Role of growth hormone and insulin-like growth factor-1 in the protective effect of ghrelin in ischemia/reperfusion-induced acute pancreatitis: Growth Horm IGF Res, 2006; 16; 348-56, pmid: 17084100
16. Ceranowicz P, Warzecha Z, Dembiński A, Treatment with ghrelin accelerates the healing of acetic acid-induced gastric and duodenal ulcers in rats: J Physiol Pharmacol, 2009; 60(1); 87-98, pmid: 19439811
17. Warzecha Z, Ceranowicz P, Dembiński A, Therapeutic effect ghrelin in the course of cerulein-induced acute pancreatitis in rats: J Physiol Pharmacol, 2010; 61; 419-27, pmid: 20814069
18. Konturek PC, Brzozowski T, Engel M, Ghrelin ameliorates colonic inflammation. Role of nitric oxide and sensory nerves: J Physiol Pharmacol, 2009; 60(2); 41-47
19. Granata R, Settanni F, Gallo D, Obestatin promotes survival of pancreatic beta-cells and human islets and induces expression of genes involved in the regulation of beta-cell mass and function: Diabetes, 2008; 57; 967-79, pmid: 18162507
20. Ceranowicz P, Warzecha Z, Dembinski A, Pretreatment with obestatin inhibits the development of cerulein-induced pancreatitis: J Physiol Pharmacol, 2009; 60(3); 95-101, pmid: 19826187
21. Dinarello CA, Proinflammatory cytokines: Chest, 2000; 118; 503-8, pmid: 10936147
22. Konturek SJ, Dembinski A, Warzecha Z, Role of epidermal growth factor in healing of chronic gastroduodenal ulcers in rats: Gastroenterology, 1988; 94; 1300-7, pmid: 2896137
23. Okabe S, Roth JL, Pfeiffer CJ, A method for experimental, penetrating gastric and duodenal ulcers in rats. Observations on normal healing: Am J Dig Dis, 1971; 16; 277-84, pmid: 5554507
24. Dembiński A, Warzecha Z, Ceranowicz P, Cannabinoids in acute gastric damage and pancreatitis: J Physiol Pharmacol, 2006; 57(Suppl 5); 137-54, pmid: 17218765
25. Konturek PC, Burnat G, Brzozowski T, Tryptophan free diet delays healing of chronic gastric ulcers in rat: J Physiol Pharmacol, 2008; 59(Suppl 2); 53-65, pmid: 18812628
26. Warzecha Z, Dembiński A, Ceranowicz P, Inhibition of cyclooxygenase-2 reduces the protective effect of hepatocyte growth factor in experimental pancreatitis: Eur J Pharmacol, 2004; 486; 107-19, pmid: 14751415
27. Warzecha Z, Dembiński A, Ceranowicz P, Dual age-dependent effect of ghrelin administration on serum level of insulin-like growth factor-1 and gastric growth in young rats: Eur J Pharmacol, 2006; 529; 145-50, pmid: 16337939
28. Chartrel N, Alvear-Perez R, Leprince J, Comment on “Obestatin, a peptide encoded by the ghrelin gene, opposes ghrelin’s effects on food intake”: Science, 2007; 315; 766, pmid: 17289961
29. Lauwers E, Landuyt B, Arckens L, Obestatin does not activate orphan G protein-coupled receptor GPR39: Biochem Biophys Res Commun, 2006; 351; 21-25, pmid: 17054911
30. Holst B, Egerod KL, Schild E, GPR39 signaling is stimulated by zinc ions but not by obestatin: Endocrinology, 2007; 148; 13-20, pmid: 16959833
31. Zhang JV, Jahr H, Luo CW, Obestatin induction of early-response gene expression in gastrointestinal and adipose tissues and the mediatory role of G protein-coupled receptor, GPR39: Mol Endocrinol, 2008; 22; 1464-75, pmid: 18337590
32. Hoff DA, Gregersen H, Hatlebakk JG, Mucosal blood flow measurements using laser Doppler perfusion monitoring: World J Gastroenterol, 2009; 15; 198-203, pmid: 19132770
33. Sorbye H, Svanes K, The role of blood flow in gastric mucosal defence, damage and healing: Dig Dis, 1994; 12; 305-17, pmid: 7533677
34. Lacy ER, Epithelial restitution in the gastrointestinal tract: J Clin Gastroenterol, 1988; 10(Suppl 1); S72-77, pmid: 3053884
35. Dinarello CA, Wolff SM, The role of interleukin-1 in disease: N Engl J Med, 1993; 328; 106-13, pmid: 8439348
In Press
Clinical Research
Institutional and Regional Variations in Access to Clinical Trials and Next-Generation Sequencing in Turkis...Med Sci Monit In Press; DOI: 10.12659/MSM.951027
Clinical Research
Low-Intensity Blood Flow-Restricted Multi-Joint Exercise Improves Muscle Function in Patients With Patellof...Med Sci Monit In Press; DOI: 10.12659/MSM.950516
Review article
Musculoskeletal Ultrasound and MRI in the Evaluation of Chemotherapy-Induced Peripheral Neuropathy: A ReviewMed Sci Monit In Press; DOI: 10.12659/MSM.951283
Clinical Research
Sensory Processing, Dissociation, and Affective Symptoms in Misophonia: A Cross-Sectional Study of 35 AdultsMed Sci Monit In Press; DOI: 10.12659/MSM.950938
Most Viewed Current Articles
17 Jan 2024 : Review article 10,187,196
Vaccination Guidelines for Pregnant Women: Addressing COVID-19 and the Omicron VariantDOI :10.12659/MSM.942799
Med Sci Monit 2024; 30:e942799
13 Nov 2021 : Clinical Research 3,708,487
Acceptance of COVID-19 Vaccination and Its Associated Factors Among Cancer Patients Attending the Oncology ...DOI :10.12659/MSM.932788
Med Sci Monit 2021; 27:e932788
14 Dec 2022 : Clinical Research 2,341,643
Prevalence and Variability of Allergen-Specific Immunoglobulin E in Patients with Elevated Tryptase LevelsDOI :10.12659/MSM.937990
Med Sci Monit 2022; 28:e937990
16 May 2023 : Clinical Research 706,524
Electrophysiological Testing for an Auditory Processing Disorder and Reading Performance in 54 School Stude...DOI :10.12659/MSM.940387
Med Sci Monit 2023; 29:e940387






