Regulates the Proliferation and Migration of H9c2 Cells

Background

Congenital heart disease (CHD), which arises from defective cardiac structure, has a global incidence of approximately 1% [1]. Individuals with CHD are at risk for heart failure and arrhythmias [2]. Common types of CHD include atrial septal defect (ASD), ventricular septal defect (VSD), patent ductus arteriosus, and tetralogy of Fallot [3], with ASD and VSD being the most common types [4]. ASD is a continuous interruption of the cardiac atrial septum, which can lead to heart failure, arrhythmia, and pulmonary hypertension. Among possible pathogenic factors leading to CHD [5, 6], genetic factors, especially abnormalities of NKX2–5 [4], are considered to be associated with the disease, especially with ASD [7].

Human NKX2–5, located at chromosome 5q35.1, consists of 3213 bases, including 3 exons. Through alternative splicing, 3 isoforms are possible [8]. All 3 isoforms are expressed in the heart, with isoform 1, which contains the homeodomain, being the most abundant [8]. Isoforms 2 and 3 lack the homeodomain [8]. Human NKX2–5 consists of 324 amino acids and contains several functional domains, including the HD domain, which has a role in DNA binding and activation of transcription [9,10]; the NK2-specific domain, which helps to regulate the transcriptional activation of NK-2-class proteins [11]; and the nuclear localization signal, which is involved in the phosphorylation of NKX2–5 [12]. NKX2–5 is conserved in mammals [13] and functions in the morphogenesis of the heart [14,15]. In mice, disruption of Nkx2–5 has been associated with arrhythmias, abnormal myocardial contraction, abnormal cardiac morphogenesis, and death [16]. Notably, the structural abnormalities of the hearts of these mice are highly similar to those of patients with CHD [16,17]. Therefore, we hypothesized that mutations in NKX2–5 are related to CHD.

Our study relied in part on miRNAs, which are noncoding RNAs that are highly evolutionarily conserved [18]. miRNAs can bind to mRNA to inhibit the expression of a target gene [19,20].

In our study, we knocked down the Nkx2–5 gene in H9c2 cells and investigated the changes in cell proliferation, migration, and the transcripts to clarify the function and mechanisms of NKX2–5 in the heart.

Material and Methods

:

The shRNA lentiviral vector GV493 was designed and made by Shanghai GeneChem. GV493 contained the following elements: hU6 (promoter), MCS (polyclonal restriction site), CBh (promoter of the enhanced green fluorescent protein [GFP] gcGFP gene), gcGFP gene, internal ribosomal entry site, and puromycin resistance gene. The inserted sequence used for knocking down Nkx2–5 was TCTCAACGCCTACGGCTACAA, and the inserted sequence for the negative control was TTCTCCGAACGTGTCACGT.

RAT CARDIOMYOCYTE CELLS AND INFECTION BY SHRNA LENTIVIRAL VECTOR:

The rat cardiomyocyte cells from the H9c2(2-1) cell line were cultured with high-glucose Dulbecco’s modified Eagle’s medium. H9c2 cells were infected by shRNA lentiviral vector with a multiplicity of infection equal to 10. Seventy-two hours after infection, puromycin at a concentration of 0.4 μg/mL was used to kill uninfected cells.

QUANTITATIVE REVERSE TRANSCRIPTION-POLYMERASE CHAIN REACTION:

After the concentration of RNA from cells of the different groups was measured, the GoScript™ Reverse Transcription Mix Oligo(dT) (Promega) was used to obtain cDNA. In total, 2000 ng of RNA was used in the 20-μL reaction system. The cDNA was diluted to 40 ng/μL with nucleic acid-free water for quantitative reverse transcription-polymerase chain reaction (qRT-PCR). Eastep®qPCRMaster MixKit (Promega) was used to complete the qRT-PCR for genes according to the manufacturer’s instructions. All-in-One™ miRNA qRT-PCR Detection Kit (GeneCopoeia) was used to complete the qRT-PCR for miRNAs according to the manufacturer’s instructions. Some qRT-PCR primers for genes were designed by Tsingke Biological Technology. Primer sequence are listed in Table 1. The qRT-PCR primers for miRNAs and some genes were purchased from GeneCopoeia. Due to the trade secrets involved, the sequence information cannot be provided. The protocols for qRT-PCR of mRNAs and miRNAs are listed individually in Tables 2 and 3. Beta-actin and U6 genes were used as internal standards. The 2−ΔΔCt method was used to calculate the relative expression levels of genes, according to the cycle threshold values of the target mRNAs, miRNAs, and internal standards, respectively.

WESTERN BLOT:

Equal amounts of protein obtained from cells in the control group and the Nkx2–5 knockdown group were separated through 10% SDS-PAGE and transferred onto a membrane. Tris-buffered saline containing 0.1% Tween-20 (TBST) was used to dissolve 5% nonfat dry milk to block the membrane for 1 h at room temperature. The membrane was then incubated with antibodies specific for NKX2–5 (Proteintech,1: 500) and β-tubulin (Proteintech, 1: 1000) at 4°C overnight. The next day, the membrane was washed 3 times with TBST and then incubated with secondary antibody (Proteintech, 1: 2000) for 1 h at room temperature. Afterward, the membrane was again washed 3 times with TBST and substrate was added for enhanced chemiluminescence.

CELL PROLIFERATION TEST:

The CCK8 method was used to detect the cells’ ability to proliferate. Cells from each group were seeded into 96-well plates at the same concentration and tested every 24 h. First, we removed the old culture medium and added 100 μL of fresh culture medium and 10 μL of CCK8 solution to each well. We then continued the cell cultures for 2 h. Finally, we measured the absorbance at 450 nm with a microplate reader and constructed the CCK8 cell proliferation curve according to the numerical values.

RNA SEQUENCING:

RNA was extracted from cells using Trizol reagent (Invitrogen), and the quantity and purity of RNA were validated. A chain-specific library was constructed by removing ribosomal RNA, and this library was sequenced using Illumina Novaseq™ 6000.

The small RNA-sequencing (RNA-seq) library was completed by using the TruSeq Small RNA Sample Prep Kits (Illumina), and this library was sequenced using Illumina Hiseq2000/2500 with a single-end read length of 50 bp. R package “ballgown” was used to screen the genes with a P-value <.05. TargetScan and Miranda were used to predict the target genes of miRNAs.

STATISTICAL ANALYSIS:

The numerical results are described as the mean±standard deviation. GraphPad Prism (version 8.3.0) was used for statistical analysis and making statistical charts according to data (mean±standard deviation). The differences between the 2 groups were analyzed using t tests (and nonparametric tests), and P<.05 indicated statistical significance.

Results

:

H9c2 cells were infected with lentivirus and amplified after puromycin selection, and qRT-PCR and western blot analysis were used to validate the effect of shRNA on Nkx2–5. The qRT-PCR and western blot results (Figure 1) indicated that the shRNA knocked down the expression of Nkx2–5.

:

The CCK8 test was used to validate the effect of Nkx2–5 on the proliferative capacity of H9c2 cells. The results indicated that the knockdown of Nkx2–5 decreased the proliferative capacity of the H9c2 cells (Figure 2).

:

The cell scratch test was used to validate the effect of Nkx2–5 on the migration of H9c2 cells. The results indicated that the knockdown of Nkx2–5 increased the migration ability of the H9c2 cells (Figure 3).

:

To investigate the mechanisms leading to changes in the proliferation and migration of H9c2 cells, we used RNA-seq on the transcripts of cells. P-value <0.05 was used to identify the differentially expressed genes, and the results indicated that the knockdown of Nkx2–5 changed the expression levels of several genes. Gene Ontology (GO) enrichment analysis (Figure 4) suggested that enriched genes involved the extracellular space, extracellular matrix, calcium-dependent phospholipid binding, regulation of calcium ion-dependent exocytosis, calcium ion-regulated exocytosis of neurotransmitter, cardiac epithelial to mesenchymal transition, development of the cardiac bundle of His, and cardiac muscle cell proliferation. Pathway enrichment analysis (Figure 5) suggested that those genes are enriched in the transforming growth factor (TGF)-β signaling pathway, and pathways related to hypertrophic cardiomyopathy, dilated cardiomyopathy, and arrhythmogenic right ventricular cardiomyopathy.

:

The CCK8 test suggested that the knockdown of Nkx2–5 in H9c2 cells decreased cell proliferation. To investigate the mechanism, we selected and analyzed genes associated with cell proliferation based on their FPKM values. In the Nkx2–5 knockdown group, the results indicated that the expression of genes related to cell proliferation was changed. Among these genes, Bche, Cd81, Col18a1, Crlf1, Ednra, Emp2, Hmga1, Ptk2b, Rxfp2, and Serpine2 were upregulated, and Cenpe, Id2, Il1rl1, LOC100359539, Ndrg1, Nkx2–5, Ripor2, Tgfb2, Tnn, and Wt1 were downregulated. The expression of the genes is shown Table 4.

:

The knockdown of Nkx2–5 was found to increase cell migration. To clarify the mechanisms, we selected and analyzed genes related to migration based on their FPKM values. In the Nkx2–5 knockdown group, the results indicated that the expression of genes related to cell migration was changed. Among these genes, Cemip, Tgfb2, and Tnn were downregulated, and Aqp1, Col18a1, Efna1, Emp2, Itga7, Lcp1, Ptk2b, and S1pr1 were upregulated. The expression of the genes is shown in Table 5.

:

To clarify the functional mechanisms of NKX2–5 in the heart, we selected and analyzed genes associated with cardiovascular morphogenesis, function, and disease based on their FPKM values. In the Nkx2–5 knockdown group, the results indicated that the expression of Cited1, Id2, Lrp2, Olfm1, Olfm2, Pou5f1, Serpina3c, Tgfb2, Wnt4, Wt1, and Xdh was downregulated, while the expression of Aqp1, Cacna1g, Chrd, Dcn, Ednra, Efna1, Eln, Emp2, Heyl, Myo7a, Nalcn, Ptk2b, Rap1gap, Ren, S1pr1, Tenm4, and Thbs2 was upregulated. The expression of the genes is shown Table 6.

:

To clarify the function of miRNAs in the heart, we used a P-value <.05, rat species, and an miRbase database to screen for differentially expressed miRNAs. The miRNAs selected through this process are depicted in the heat map shown in Figure 6. The miRNAs are listed in Table 7. The target genes of the miRNAs were analyzed after prediction, and GO analysis (Figure 7) indicated that they are related to transcriptional regulation, redox, signal transduction, apoptosis, cell differentiation, cell proliferation, protein phosphorylation, proteolysis, intracellular signal transduction, protein ubiquitin, gene expression, protein binding, metal ion binding, ATP binding, homologous protein binding, homologous domain protein dimerization body activity, DNA binding, RNA binding, zinc ion binding, and calcium ion binding. Pathway enrichment analysis (Figure 8) suggested that the target genes are enriched in the MAPK signaling pathway and other signaling pathways.

VALIDATION OF RNA-SEQ:

We used qRT-PCR to validate the RNA-seq results. The results from the Nkx2–5 knockdown group (Figures 9, 10) showed that the expression of Tgfb-2 (0.62±0.03), Wnt4 (0.56±0.19), Xdh (0.70±0.12), Lrp2 (0.69±0.12), Cited1 (0.64±0.28), Syt1 (0.78±0.16), Emp2 (0.15±0.06), Pou5f (0.75±0.11), Itga7 (0.89±0.04), rno-miR-1-3p (0.14±0.04), rno-let-7a-5p (0.73±0.13), rno-miR-148b-3p (0.32±0.03), rno-miR-361-3p (0.09±0.01), and rno-miR-25-3p(0.45±0.03) was downregulated, and the expression of Id2 (1.58±0.16), Cacna1g (1.64±0.41), Wt1 (5.22±1.57), Hey1 (3.01±1.62), Olfml (2.65±0.31), Slrp1 (2.30±0.33), Nectin3 (1.80±0.27), Tenm4 (2.51±0.82), Bmp10 (35.62±3.18), rno-miR-1-5p (1.31±0.09), rno-miR-149-5p (1.37±0.22), and rno-miR-455-3p (1.72±0.28) was upregulated.

Discussion

In this study, we found that Nkx2–5 regulates the proliferation and migration of H9c2 cells, as well as the expression of genes associated with proliferation, migration, heart development, and heart disease. Bioinformatics analysis suggested that the genes that were differentially expressed following knockdown of Nkx2–5 are enriched in cardiac development, calcium ion-related biological activity, the TGF-β signaling pathway, pathways related to heart diseases, the MAPK signaling pathway, and other biological processes and signaling pathways.

Cardiac development includes the proliferation, migration, and differentiation of heart precursor cells [21,22]. Cardiac development starts on both sides of the front of the mesoderm, with cells from the heart-forming regions migrating and forming the heart tube [21,22]. The heart tube subsequently twists and cyclizes into a 3-dimensional heart structure [21,22]. With the differentiation of cardiac precursor cells, the heart gradually achieves contraction and relaxation related to the pumping function [23]. Therefore, the proliferation, migration, and differentiation of the heart precursor cells are necessary for cardiac morphogenesis and function. In a previous study, the knockout of Nkx2–5 in mice resulted in abnormal heart development, growth arrest, and embryo death [24]. Histological examination revealed that the structure of the heart tube occurred normally, but the heart tube failed to twist and form the 3-dimensional heart structure [24]. In our study, the knockdown of Nkx2–5 in H9c2 rat cardiomyocytes changed cell proliferation and migration, as well as gene expression. The results from qRT-PCR showed that in the Nkx2–5 knockdown group, the expression of Tgfb-2, Wnt4, Xdh, Lrp2, Cited1, Syt1, Emp2, Pou5f, Itga7, rno-miR-1-3p, rno-let-7a-5p, rno-miR-148b-3p, rno-miR-361-3p, and rno-miR-25-3p was downregulated, and the expression of Id2, Cacna1g, Wt1, Hey1, Olfml, Slrp1, Nectin3, Tenm4, Bmp10, rno-miR-1-5p, rno-miR-149-5p, and rno-miR-455-3p was upregulated. Among the genes with altered expression, Tgfb-2, Bmp10, Id2, Wt1, Hey1, Cacna1g, and miR-1-3p are associated with cardiac morphogenesis and function.

TGF-β2 has functions in many biological activities [25]. Mice with dysfunction of TGF-β2 have been shown to have developmental defects of multiple organs leading to death at birth [26]. In addition, TGF-β2-deficient mice were found to develop outflow tract malformations, permanent arterial trunks, membrane peripheral VSD, aortic valve hypertrophy, tricuspid valve deformity, and complete atrioventricular septal defect [27]. These findings suggest that the disruption of TGF-β2 results in the incomplete twisting of the heart tube and abnormal development of the atrioventricular septum [27]. In our study, we found that Nkx2–5 knockdown changed the expression of Tgf-β2 and Bmp10. Further, our bioinformatics analysis indicated that the TGF-β signaling pathway was enriched. Together, these results suggest that NKX2–5 affects the TGF-β signaling pathway through Tgf-β2, Bmp10, and other genes and thereby influences the regulation of cardiac development.

Id2 is expressed in endocardial pads, inflow tracts, outflow tracts, and developing heart valves [28,29], as well as in the cardiac neural crest [29,30]. The Id protein functions in myogenesis [31] and in cell growth, differentiation, and neurogenesis [32]. The disruption of Id2 results in defects in the structures related to the cardiac neural crest [29,30]. In our study, we found that Nkx2–5 knockdown changed the expression of Id2, which was similar to results reported by Lim et al. [33]. Therefore, we suggest that NKX2–5 regulates the formation of the structures related to the cardiac neural crest through Id2.

Wt1 functions in the epicardial epithelial-mesenchymal transition (EMT) process through Snai1 and Cdh1 [34]. The epicardial EMT process is thought to be involved in the development of the heart [34,35]. Knockout of Wt1 resulted in decreased proliferation of dense myocardial cells, abnormal coronary artery formation, defects in the EMT process, and abnormal activation of the Wnt signaling pathway [34,36]. In the present study, the knockdown of Nkx2–5 in H9c2 cells changed the expression of Wt1, suggesting that NKX2–5 may regulate the epicardial EMT process through Wt1.

Hey1 belongs to the Hey gene family [37], which includes Hey1, Hey2, and HeyL [38,39]. Hey1 is expressed in the endocardial layer of the atrioventricular tube, which forms the membranous septum and valves of the heart [39]. Previously, knockout of Hey1 and HeyL was shown to damage the endocardial EMT process and result in VSD and dysplastic valves [39,40]. The knockdown of Nkx2–5 in H9c2 cells in the current study changed the expression of Hey1, suggesting that NKX2–5 may regulate the morphogenesis of the membranous septum and valves of the heart through Hey1.

Human CACNA1G, which is homologous to rat Cacna1g, is also called Cav3.1. Cav3.1 participates in the heart’s electrophysiological activities [41,42]. After myocardial infarction in mice, knocking down Cav3.1 decreased the myocardial contractile function and increased the cardiac rhythm variation [43]. In our study, the knockdown of Nkx2–5 changed the expression of Cacna1g, suggesting that NKX2–5 may regulate cardiac electrophysiological activity through Cacna1g.

miRNA1 functions in the heart [44,45]. Previously, the knockout of miRNA1 resulted in a lack of the characteristic striped appearance in the mouse myocardium, and knockdown of miRNA1 resulted in VSD and cardiac dysfunction [46]. In our study, the knockdown of Nkx2–5 altered the expression of rno-miR-1-3, suggesting that NKX2–5 may regulate cardiac development and function through miRNA1.

Conclusions

Nkx2–5 regulates cell proliferation and migration and the expression of genes associated with proliferation, migration, heart development, and disease in H9c2 cells. Genes associated with these activities include Tgfb-2, Id2, Ptk2b, Cacna1g, Wt1, Heyl, Olfml, Wnt4, Xdh, Lrp2, Cited1, Syt1, Emp2, Pou5f, Syt13, Itga7, Fos, Slrp1, Nectin3, Tenm4, Bmp10, rno-miR-1-5p, rno-miR-1-3p, rno-let-7a-5p, rno-miR-148b-3p, rno-miR-149-5p, rno-miR-361-3p, rno-miR-455-3p, and rno-miR-25-3p. Bioinformatics analysis suggested that genes that were differentially expressed because of Nkx2–5 knockdown are enriched in cardiac development, calcium ion-related biological activity, the TGF-β signaling pathway, pathways related to heart diseases, the MAPK signaling pathway, and other biological processes and signaling pathways.